ID: 929755540

View in Genome Browser
Species Human (GRCh38)
Location 2:44761104-44761126
Sequence GAGGTGGCCAACTGGGGAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 2, 3: 36, 4: 422}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929755532_929755540 -4 Left 929755532 2:44761085-44761107 CCCTTGGGGGCAGGGAGTGGAGG 0: 1
1: 0
2: 6
3: 53
4: 552
Right 929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG 0: 1
1: 0
2: 2
3: 36
4: 422
929755534_929755540 -5 Left 929755534 2:44761086-44761108 CCTTGGGGGCAGGGAGTGGAGGT 0: 1
1: 2
2: 3
3: 60
4: 591
Right 929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG 0: 1
1: 0
2: 2
3: 36
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929755540 Original CRISPR GAGGTGGCCAACTGGGGAGG AGG Intronic
900097924 1:947871-947893 GTGGTTCCCACCTGGGGAGGAGG + Intronic
900585883 1:3432163-3432185 GAGGAGGCCAGGTGGGGTGGGGG - Intronic
900633845 1:3652337-3652359 GACGCGGCCAGCTGGAGAGGCGG + Intronic
900672662 1:3865530-3865552 GAGGAGGCCAAATGGGAAAGCGG + Intronic
900884528 1:5405119-5405141 GAGGTGGGCTCCTGGGGGGGGGG - Intergenic
900891837 1:5455043-5455065 GAGCTGGCCATCTGGGAATGAGG - Intergenic
901181000 1:7341844-7341866 GAGCTGGCCTCCTGGGGAGGAGG + Intronic
901239969 1:7687227-7687249 GAGCTGGCCAAGGAGGGAGGGGG + Intronic
901815654 1:11791954-11791976 GAGTTGGCCAACAGGAGAGAAGG - Intronic
902704182 1:18193078-18193100 GAAGTGGCCCACAGGGAAGGGGG + Intronic
903512559 1:23887238-23887260 GAAGTAGCCAAGTGGGGATGTGG - Intronic
903968123 1:27102301-27102323 GAGGTGGCCACCTGGGGGGCGGG - Intronic
904025981 1:27504121-27504143 AAGGTGGCCAAGTGGGCAGGGGG + Intergenic
904341318 1:29836850-29836872 AAGTAGGCCAACGGGGGAGGGGG - Intergenic
904369643 1:30040307-30040329 GAGGAGGCCCACAGGTGAGGTGG + Intergenic
904464681 1:30700828-30700850 GAGGGGGCCAGCTGGGAAGCCGG + Intergenic
904477755 1:30775799-30775821 GAGGAGAGCAACTGGGGAGCGGG + Intergenic
905182725 1:36176794-36176816 GAGGCGGGCACGTGGGGAGGCGG - Exonic
905553128 1:38859705-38859727 GCGGAGGCGGACTGGGGAGGCGG - Exonic
905807302 1:40886183-40886205 AAGGAGGGCACCTGGGGAGGTGG - Intergenic
905944602 1:41890997-41891019 GAGCAGGCCAGCTGGAGAGGTGG + Intronic
906524749 1:46487630-46487652 GAGGTGGGGACCTAGGGAGGAGG + Intergenic
907328442 1:53656064-53656086 GATCTGGCCAACTGGGGAAGGGG + Intronic
910981058 1:92960962-92960984 GCGGGGGCCCACGGGGGAGGGGG + Intronic
911661562 1:100507748-100507770 GAGGTGGAGAACCTGGGAGGTGG - Intronic
913199332 1:116483508-116483530 ATGGTGTCCACCTGGGGAGGAGG - Intergenic
914679514 1:149929307-149929329 GAGAGGCCCATCTGGGGAGGAGG + Exonic
914869089 1:151458699-151458721 GCGGTGGCCCGCTGGGGAAGGGG - Intronic
914915122 1:151814893-151814915 TAGGTGAGCAGCTGGGGAGGTGG - Exonic
915944035 1:160136789-160136811 GTGGTGGCCAACTGGGACTGGGG + Intronic
916583171 1:166126539-166126561 GAGTTGGCCATCTGGGGGAGGGG + Intronic
916651734 1:166839785-166839807 GAGGGGGCCAGGTGGGGAGGCGG + Intronic
917210078 1:172622153-172622175 GAGGTGGGAAACTGGGTAGCAGG + Intergenic
919764650 1:201118946-201118968 GAGGTGGGAAACTGAGGTGGTGG - Intronic
919776908 1:201200175-201200197 CAGGTGGCCAACAGAGGAGCAGG + Intronic
919867513 1:201793450-201793472 GGTGTGGCCAACTTGGTAGGCGG - Intronic
920821535 1:209386273-209386295 GAGGCTGCCCACTAGGGAGGTGG - Intergenic
922201376 1:223404409-223404431 GAGGTGGGGAGGTGGGGAGGTGG - Intergenic
922719462 1:227892989-227893011 GAGGTGGTCAGCAGGGGAGATGG - Intergenic
922817013 1:228457159-228457181 GGGGTGGCCACCTGTGGACGAGG + Exonic
924436883 1:244049454-244049476 GAGGGGGCCGGCGGGGGAGGGGG + Intronic
1063666036 10:8061301-8061323 GAGATGCCCAACTGGAAAGGTGG - Intronic
1065684538 10:28270543-28270565 GAGGAGGGGAGCTGGGGAGGGGG + Intronic
1065717403 10:28585576-28585598 GATGAGGCCAAGTGGGGAGAAGG + Intronic
1067036619 10:42925691-42925713 GAGGTGGGCTGGTGGGGAGGGGG - Intergenic
1067175560 10:43943402-43943424 GGGGTGGCTGAGTGGGGAGGTGG + Intergenic
1067214765 10:44293020-44293042 GAGGTGGGGAGGTGGGGAGGGGG + Intronic
1067719261 10:48714789-48714811 GAGATAGACAACTTGGGAGGTGG + Intronic
1069829096 10:71271780-71271802 AAGGTGGCCAGCTGGGGCAGGGG - Intronic
1069863697 10:71487026-71487048 GGGGAGGCCAACAGGGGAAGGGG - Intronic
1070810084 10:79293268-79293290 GAGGTGGAGGAGTGGGGAGGGGG - Intronic
1071679119 10:87686537-87686559 GAGGTGGTCCACTGGCTAGGAGG - Intronic
1073015115 10:100392677-100392699 GATGTAGACAACTGGGGCGGAGG - Intergenic
1073288061 10:102400199-102400221 GGGGGCGCCTACTGGGGAGGTGG + Intronic
1073485448 10:103814973-103814995 TGGCAGGCCAACTGGGGAGGTGG + Intronic
1073585338 10:104704533-104704555 GAGGAGGGAAACTGGGGATGGGG + Intronic
1074027536 10:109652133-109652155 TCTGTGGCCAAGTGGGGAGGTGG - Intergenic
1076677152 10:132153092-132153114 GAGGTGGTGATCTCGGGAGGAGG + Intronic
1076701305 10:132274763-132274785 GAGGTGGCCGACTGCCGAGGAGG - Intronic
1076889664 10:133277340-133277362 CAGGCGTCCAAGTGGGGAGGGGG + Intergenic
1076890851 10:133282613-133282635 GAGGAGGGCGAGTGGGGAGGTGG - Intronic
1077146379 11:1048078-1048100 GAGGTGGGGACTTGGGGAGGTGG + Intergenic
1077564778 11:3290685-3290707 GAGGGGGCCTTCTGGGGCGGGGG - Intergenic
1077570668 11:3336502-3336524 GAGGGGGCCTTCTGGGGCGGGGG - Intergenic
1077860403 11:6172945-6172967 GATGTGGATACCTGGGGAGGGGG + Intergenic
1077877548 11:6320584-6320606 GAGTTGGCCTTCTGGGGCGGCGG + Exonic
1081990947 11:47337337-47337359 GAGGTTTTTAACTGGGGAGGGGG + Intronic
1082770906 11:57206770-57206792 GAGTTGGCCAAGTGAAGAGGTGG - Intergenic
1083027204 11:59560858-59560880 GAGGTGGGCACCTGGGATGGAGG - Intergenic
1083476739 11:62920341-62920363 GGGCAGGCCAGCTGGGGAGGGGG - Intronic
1083490016 11:63009199-63009221 GAGATGGGCAACTGGGGACTGGG + Intronic
1083596220 11:63919308-63919330 GAGGGGGCCAGCTGGGGAGGGGG - Intergenic
1083609944 11:63999896-63999918 GAGGGGGCCCACAGGGGTGGGGG - Intronic
1083916013 11:65744256-65744278 GAGGTGGCCAAGGTGGCAGGGGG - Intergenic
1083931514 11:65848786-65848808 GAGGTAGCCAGCTGGGGAAGGGG + Intronic
1084774045 11:71363966-71363988 GAGGAGGCAGGCTGGGGAGGTGG + Intergenic
1085039765 11:73319990-73320012 AAGGTGGGCACCTAGGGAGGGGG + Intronic
1086391919 11:86374399-86374421 GAGCTGGAGAAGTGGGGAGGAGG - Intergenic
1086474210 11:87152995-87153017 GAGGTGGAGAACTGGAGAAGAGG - Intronic
1088147706 11:106702812-106702834 GATGTGGACATCTTGGGAGGTGG - Intronic
1088837545 11:113590546-113590568 GAGGTGGGCTAATGGGTAGGGGG + Intergenic
1089564062 11:119361597-119361619 GAGGTTGTCAGCTGGGGGGGAGG + Intronic
1089700181 11:120240012-120240034 GAGCTGGGGACCTGGGGAGGGGG - Intronic
1090271385 11:125388690-125388712 GGGGCGGCCAGCTGGGGATGGGG - Intronic
1090352182 11:126114686-126114708 AAGGCAGCCAGCTGGGGAGGTGG - Intergenic
1090407256 11:126484167-126484189 GAGGTGCTCAGGTGGGGAGGGGG - Intronic
1090533518 11:127615702-127615724 GAACTGGCCAACTGGGGATCTGG + Intergenic
1091028782 11:132164991-132165013 GTGTAGGCCAACAGGGGAGGGGG - Intronic
1091094292 11:132804355-132804377 AAGGTGGCAAACTAGAGAGGAGG + Intronic
1091174550 11:133546746-133546768 GAGGAGGCCACACGGGGAGGAGG - Intergenic
1091659232 12:2370866-2370888 GCGGTGTCCAGGTGGGGAGGGGG + Intronic
1092654820 12:10673627-10673649 GAGGGGGCCATCAGGAGAGGGGG - Intronic
1092974339 12:13729806-13729828 GAGGAAGCCATATGGGGAGGGGG + Intronic
1095102819 12:38201752-38201774 GAACTGGCCAGCTGGCGAGGCGG + Intergenic
1095295578 12:40523664-40523686 AAGGTGACCTACTGGGAAGGAGG - Intronic
1095960700 12:47832792-47832814 CAAGAGGCCAAGTGGGGAGGAGG - Intronic
1096571930 12:52528562-52528584 GAGGTGGCGATCTGGTTAGGAGG - Intergenic
1096692336 12:53328797-53328819 GAGGTGGGGAGCTGGGTAGGGGG + Exonic
1096866842 12:54569473-54569495 GGTGTGGCCAGCTGGGGATGTGG - Intronic
1097915307 12:65014612-65014634 GAGGTGGCCAACTGGATCTGGGG + Intergenic
1101498483 12:105278669-105278691 GAGGTAGCCAAATGGATAGGAGG - Intronic
1101563528 12:105882707-105882729 GAAGTAGGCCACTGGGGAGGAGG - Intergenic
1102010229 12:109613696-109613718 GACGACGCCAGCTGGGGAGGTGG - Intergenic
1102851230 12:116246881-116246903 GAGGTGGGGAGGTGGGGAGGCGG + Intronic
1103102362 12:118189746-118189768 GAGGCTGCCAGATGGGGAGGAGG + Intronic
1103724165 12:122989640-122989662 GACTTGGCCATCTAGGGAGGAGG - Intronic
1103893357 12:124256282-124256304 TAGGTGGTTACCTGGGGAGGGGG - Intronic
1104811110 12:131620965-131620987 GAGCTGGCTATCCGGGGAGGGGG + Intergenic
1104983199 12:132583012-132583034 GGGGTGGCCAGCGGGGGTGGCGG - Exonic
1104984453 12:132588715-132588737 GAGGTGGCCACCTGAGGACAAGG - Intergenic
1105751759 13:23427359-23427381 GAGGTTCCAAGCTGGGGAGGAGG - Intronic
1106019161 13:25898680-25898702 AAGGTGGCCAGCTGGGAAGCTGG - Intronic
1107011788 13:35677519-35677541 GAGCTGGCCAGCAGGGGAGTTGG - Intergenic
1107224897 13:38036863-38036885 GTGGTGGACAACTGGAAAGGAGG - Intergenic
1107352914 13:39534681-39534703 GTGGTGGAGACCTGGGGAGGTGG + Intronic
1110486618 13:76051978-76052000 GAGGTGGGGAGGTGGGGAGGTGG - Intergenic
1111333342 13:86790398-86790420 GAGATGGCCATCTAGGGAGTTGG - Intergenic
1111768239 13:92562175-92562197 GAGCTGGCAAGCTGGTGAGGAGG - Intronic
1112873348 13:104002589-104002611 GAAGAGGTTAACTGGGGAGGAGG - Intergenic
1112998281 13:105600735-105600757 GATGTGTCCAAATGGGGTGGTGG - Intergenic
1113179480 13:107609117-107609139 GAGGTGGCCAGGGAGGGAGGTGG - Intronic
1113330150 13:109319133-109319155 GAGGGAGCCCATTGGGGAGGGGG + Intergenic
1113933264 13:113979823-113979845 GAGGTGTGCATGTGGGGAGGAGG - Intronic
1113939434 13:114010726-114010748 GAGGGGGCCATGTGAGGAGGAGG + Intronic
1113939443 13:114010745-114010767 GAGGGGGCCGCGTGGGGAGGTGG + Intronic
1113939456 13:114010772-114010794 GAGGGGGCCGCGTGGGGAGGAGG + Intronic
1114224659 14:20726514-20726536 GAGATGGCAACCTGAGGAGGTGG + Intergenic
1114645309 14:24252729-24252751 GGGGTGGGCAAGTGGGCAGGGGG + Intronic
1115347760 14:32361458-32361480 GAGGTGGCAAACAGGGAAGTTGG + Intronic
1117494917 14:56293592-56293614 GGGGTTGCAAACTGGGGATGTGG + Intronic
1118753150 14:68820990-68821012 GATGGGGCCATCTGGGGAGCAGG - Intergenic
1119193272 14:72698967-72698989 GACGTGGGCAACTGGGTAGAAGG + Intronic
1119226168 14:72946096-72946118 GAGGAGAGCAACTGGGGAAGAGG + Intronic
1119620938 14:76131361-76131383 GAGGGGGCGGGCTGGGGAGGGGG + Intergenic
1119776497 14:77252343-77252365 GAGGTGGCCATGTTTGGAGGTGG + Intronic
1120392050 14:83921421-83921443 GGGGTGGGGAAATGGGGAGGTGG + Intergenic
1121144704 14:91573959-91573981 GAGGCGGCCGATGGGGGAGGAGG + Intergenic
1121525351 14:94615540-94615562 GAGGTGGCCAGGTGGGGCTGGGG + Intronic
1122302523 14:100739102-100739124 GTGGTGGCCAAGGGAGGAGGCGG - Intergenic
1122781972 14:104147526-104147548 GAGGTGCCCAGCTGGGCAGGAGG + Intronic
1122886865 14:104714079-104714101 GAGGAGGCTTTCTGGGGAGGAGG + Intronic
1123026236 14:105425673-105425695 GAGCAGGCCAGCTGGGGTGGGGG - Intronic
1123145278 14:106123871-106123893 CAGGTGCACAGCTGGGGAGGAGG - Intergenic
1124127227 15:26947056-26947078 GATGTGGCCTGCTGGGAAGGAGG - Intronic
1128136347 15:65266495-65266517 GAGGTGGGAGAGTGGGGAGGGGG - Intronic
1128341679 15:66826696-66826718 GTGCTTGCCACCTGGGGAGGAGG - Intergenic
1129114724 15:73358897-73358919 GAGGTGGCAAAATGGAGAGTAGG - Intronic
1129662146 15:77558978-77559000 GAGGTGGGCATCAGGGAAGGAGG + Intergenic
1129886771 15:79043680-79043702 GAAGTGGCTACCTGGGGAGATGG + Intronic
1130367652 15:83254615-83254637 GTGGTGGGCAATGGGGGAGGAGG + Intergenic
1131189440 15:90301718-90301740 GAGGTGGCGCACTTTGGAGGGGG + Intronic
1132298898 15:100764312-100764334 GTGGAGCCCACCTGGGGAGGTGG + Intergenic
1132847078 16:2005609-2005631 GGGGTGCCAAAGTGGGGAGGTGG - Intronic
1132900522 16:2251602-2251624 GAGCTCGCCTCCTGGGGAGGGGG + Exonic
1133183967 16:4081810-4081832 GAGGGGGGCAGCAGGGGAGGAGG + Intronic
1133732616 16:8589902-8589924 GCGGTGGCCGGCTGGGGACGGGG - Intergenic
1133978451 16:10617007-10617029 GAGCTGCCCCTCTGGGGAGGGGG + Intergenic
1136029376 16:27491744-27491766 GAGGAGGCCATGTGGGTAGGAGG - Intronic
1136033312 16:27519224-27519246 GAAGGGGCCTACTGGGGAAGGGG + Intronic
1136540760 16:30926584-30926606 GAGGTGGCAGAGTGGGGAGGGGG - Intronic
1136544242 16:30947040-30947062 GCGGTGGCAACCTGGGGATGGGG - Exonic
1136580618 16:31149003-31149025 GAGGGGACCAACTGCGGGGGCGG + Intronic
1136923638 16:34351247-34351269 GAGATCTCCATCTGGGGAGGGGG - Intergenic
1136980935 16:35060559-35060581 GAGATCTCCATCTGGGGAGGGGG + Intergenic
1137845292 16:51681819-51681841 GAGTTGGCCATGTGGGTAGGAGG - Intergenic
1138417042 16:56877658-56877680 CAGGCGGCCAGCTGGGCAGGGGG - Intronic
1139138474 16:64233433-64233455 GAGGTGGCCAAGGTGGTAGGGGG - Intergenic
1139504169 16:67390864-67390886 GAGGTGGGGAACTGGGGGGCTGG - Intronic
1139872756 16:70120622-70120644 CAGGTGGTCATCTGTGGAGGTGG + Exonic
1140187386 16:72787465-72787487 GCGGCGGCCGACGGGGGAGGGGG + Exonic
1141307958 16:82884309-82884331 AAGGAGGCAACCTGGGGAGGGGG + Intronic
1142475259 17:184943-184965 GAGGTGGGCAGCTGGGCAGCTGG + Intergenic
1143307778 17:5961209-5961231 GAGGTGGCCAGCTCTGGTGGGGG + Intronic
1143780532 17:9226497-9226519 GAGGTGGTCTCGTGGGGAGGTGG + Intronic
1143780537 17:9226513-9226535 GAGGTGGTCTCGTGGGGAGGCGG + Intronic
1143918404 17:10311836-10311858 GCTGTGGCCAAATGGGGAAGGGG + Intronic
1144334353 17:14255647-14255669 GGGGTGGCCAGCAGGGGAAGAGG - Intergenic
1144727535 17:17509391-17509413 GAGGTGGCCAGCAGGGCAGAGGG + Intronic
1145912413 17:28550263-28550285 GAGGTGGCAGAGTGGGGAGCAGG + Intronic
1146445706 17:32931374-32931396 GAAGTGGCAAATTGGGGAAGAGG - Exonic
1146648720 17:34592830-34592852 GAGGTGGGAATGTGGGGAGGTGG - Intronic
1147457719 17:40548759-40548781 GAGGGGGGCAACTGAGAAGGAGG + Intergenic
1147535376 17:41317428-41317450 GAGGTGCCCATCTGTGGATGTGG - Intergenic
1147846442 17:43407242-43407264 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
1147846446 17:43407250-43407272 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
1147846450 17:43407258-43407280 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
1148334714 17:46833476-46833498 GAGGTGACCAGATGGGGAGTCGG - Intronic
1148753409 17:49959256-49959278 GAGGAAGGCAGCTGGGGAGGTGG + Intergenic
1149641581 17:58206254-58206276 GGGGTGGCCAGCTGGGGGAGGGG + Intronic
1150210886 17:63440866-63440888 GAGGCGGCGACCTGGAGAGGAGG - Intronic
1150283696 17:63943911-63943933 GAGGTGCCCCACTGAGGTGGGGG - Intronic
1150637034 17:66920329-66920351 GAGGAGGCCAGCAGGAGAGGAGG - Intergenic
1151849994 17:76684537-76684559 GGGGTGTCCAAATGGGAAGGGGG + Intronic
1152034194 17:77861925-77861947 GTGGAGGCCAACTGGGGAATAGG + Intergenic
1152620729 17:81363473-81363495 GAGGAGGCATCCTGGGGAGGTGG - Intergenic
1152799420 17:82323957-82323979 GAGGTGGACAACATGGGAGTGGG + Intronic
1153580764 18:6571332-6571354 GGGGTGGCCAATAGGGGAGGAGG - Intronic
1156268199 18:35507446-35507468 GAGGTGGGCCACTGGGTGGGTGG + Intergenic
1157203127 18:45676299-45676321 CAGGTGGCCCGGTGGGGAGGTGG + Intronic
1157506208 18:48228510-48228532 GAGGGGTCCTACTGGGGAGGAGG - Intronic
1157953292 18:52064640-52064662 GAGGAGACCAAGTGGGGAGCTGG + Intergenic
1158515001 18:58123522-58123544 GGGGTGTCCAACCGGGGCGGGGG - Intronic
1158648757 18:59268906-59268928 GAGGGGCCGAGCTGGGGAGGGGG + Exonic
1160726210 19:618878-618900 GGGGTGGCACACTGGGGCGGTGG + Intronic
1160803166 19:979808-979830 GAGGTGGGGGCCTGGGGAGGAGG - Intergenic
1160803190 19:979861-979883 GAGGTGGGGGCCTGGGGAGGAGG - Intergenic
1160803215 19:979916-979938 GAGGTGGGGGCCTGGGGAGGAGG - Intergenic
1160803240 19:979971-979993 GAGGTGGGGGCCTGGGGAGGAGG - Intergenic
1160803265 19:980026-980048 GAGGTGGGGGCCTGGGGAGGAGG - Intergenic
1161211161 19:3066586-3066608 GACTTGGCCAAGTGGGTAGGGGG + Intergenic
1161399392 19:4060684-4060706 GAGGTGGGCGACCGGGGAAGGGG + Intronic
1161438807 19:4279323-4279345 GAGGTGGGACGCTGGGGAGGGGG - Exonic
1161531392 19:4792120-4792142 CAGGTGGCCGGCTGCGGAGGCGG - Exonic
1162000956 19:7744878-7744900 CTTCTGGCCAACTGGGGAGGAGG - Intronic
1162004220 19:7766848-7766870 CTTCTGGCCAACTGGGGAGGAGG + Intronic
1162029800 19:7912482-7912504 TGGGTGGCCAAGTGGGGAGGGGG - Exonic
1162142429 19:8592697-8592719 GGCGTGGCCAACGCGGGAGGTGG + Intronic
1162794333 19:13078756-13078778 GAGGGGGGCAGTTGGGGAGGTGG + Intronic
1162827789 19:13264291-13264313 AAGGTGACCCACTGGGGATGGGG - Intronic
1162947822 19:14054467-14054489 GAGGGGGCCAAGACGGGAGGAGG - Exonic
1162958873 19:14114574-14114596 GAGCTGGCCCACAGGGGAAGGGG - Intronic
1163112529 19:15170211-15170233 GAGGTGTCCAGCTGGGAAGGAGG + Intronic
1163162298 19:15471863-15471885 GAGGGGCCCGACCGGGGAGGGGG - Intronic
1163169033 19:15517952-15517974 GAGGTGAGCAAGTGAGGAGGAGG + Intronic
1163783237 19:19261381-19261403 GAAGTGGCCAAGTGCGGAGAGGG - Intronic
1164598666 19:29546820-29546842 GAGATGGAAAACTGGAGAGGAGG + Intronic
1164792765 19:31002186-31002208 GAGCTGCCCATATGGGGAGGCGG + Intergenic
1165130966 19:33631770-33631792 GAGGTGGCTGCCTGGGGTGGAGG - Intronic
1166211071 19:41306799-41306821 GAGGTGGAAGGCTGGGGAGGTGG - Exonic
1166356526 19:42230528-42230550 GAGGGGGCCAAGGGGGTAGGAGG + Exonic
1166557321 19:43709282-43709304 GAGGTGGGCAGTTGGGGAAGGGG - Intergenic
1166781516 19:45345804-45345826 GAGGGGGCCAGGTGGGGAGCTGG + Intronic
1166867743 19:45850944-45850966 CAGGTGGCAACCTGGGGACGAGG + Intronic
1167249940 19:48394328-48394350 GAGGTGGCCAAGCGAGGAAGGGG + Intergenic
1167278782 19:48554318-48554340 GAGATGGGCAACCTGGGAGGAGG - Intronic
1168587351 19:57604170-57604192 GAGGTGGGGAGATGGGGAGGAGG + Intronic
925171707 2:1754226-1754248 GGGGAGGCCGGCTGGGGAGGTGG - Intergenic
925507463 2:4584230-4584252 GAGGTGGGGAAGTGAGGAGGTGG - Intergenic
926008161 2:9388806-9388828 GAGGTGGCCAACTGGGCTCCCGG + Intronic
927083156 2:19650223-19650245 GAGATGGGGAACTGGGGAAGTGG + Intergenic
928205697 2:29281731-29281753 GAGGTGGCCATCTGGGCAGTGGG + Intronic
929236491 2:39610560-39610582 GAGATGGGAAACTGGGGAGGGGG + Intergenic
929589291 2:43134643-43134665 GAGGAGGGCAAGTGGGGTGGAGG + Intergenic
929755540 2:44761104-44761126 GAGGTGGCCAACTGGGGAGGAGG + Intronic
930858005 2:56039733-56039755 GAAGTGGCGAGCTGGGGATGAGG - Intergenic
931996574 2:67844413-67844435 GAGGTGGGAGAATGGGGAGGTGG - Intergenic
932099284 2:68882167-68882189 GGGGAGGACAACTGGGAAGGAGG + Intergenic
932228701 2:70064301-70064323 GAGGTGGGGCACTAGGGAGGGGG - Intergenic
932495264 2:72143055-72143077 GCGGTGGCAGACCGGGGAGGTGG - Intronic
933660815 2:84925888-84925910 CTGGTGGCCAGCTGTGGAGGTGG + Intergenic
936071709 2:109375620-109375642 GCCCTGGCCCACTGGGGAGGAGG - Intronic
936462017 2:112721156-112721178 GAGATGGGCACCTGGGGTGGGGG + Intergenic
937081265 2:119141725-119141747 GAGGGGAGGAACTGGGGAGGAGG - Intergenic
937255551 2:120552922-120552944 GAGGAAGCCAACTGTGCAGGAGG - Intergenic
939141014 2:138354638-138354660 TATGTGGCCAGCTGGGGAAGTGG + Intergenic
939189241 2:138897098-138897120 GAGGTGGCCAACTGTGAGGAAGG - Intergenic
941524653 2:166592224-166592246 GTGGAGGCCCACTGGGGAGCTGG - Intergenic
942004220 2:171681376-171681398 GAGGTTGGAAACAGGGGAGGAGG + Intergenic
942444897 2:176071378-176071400 GAGGTGGCCCACTCCGGAGAGGG + Intergenic
943727020 2:191262295-191262317 AAGTGGGCCAGCTGGGGAGGAGG - Intronic
944905348 2:204256577-204256599 GAGGTGGGGAGATGGGGAGGTGG - Intergenic
945639151 2:212400296-212400318 GCTGTGGCCTAATGGGGAGGTGG + Intronic
946166839 2:217869587-217869609 CAGGCGGCCACATGGGGAGGAGG + Intronic
947531579 2:230912030-230912052 GAGGCGGGCAAGTGGGGAGAGGG - Intronic
948051371 2:234981948-234981970 GAGGTGGCCACCCAGGAAGGAGG - Intronic
948699374 2:239750682-239750704 GAGGTGTCCAGGTGGGGAGGTGG - Intergenic
948943807 2:241209504-241209526 GAGGCGGCAAACTGGGGCCGAGG - Exonic
1169207789 20:3749761-3749783 GTGGTGGCCGACTGCGGCGGAGG + Exonic
1169758492 20:9067833-9067855 GAGGAGGCGGAGTGGGGAGGAGG + Intergenic
1171183900 20:23111361-23111383 CAGGTGGTTAACTTGGGAGGTGG + Intergenic
1171201425 20:23245124-23245146 GAGGTGGCCAGGTGGGGACCCGG - Intergenic
1172097584 20:32467847-32467869 GAGGAGGCACACAGGGGAGGGGG + Intronic
1172427174 20:34863288-34863310 GAGGGGGACAAATGGGGAGGGGG - Intronic
1172843813 20:37917703-37917725 GTGGTGGCTAACAGGGGAAGGGG - Intronic
1172941722 20:38658991-38659013 GAGGTGGAGGACTTGGGAGGTGG - Intergenic
1172995137 20:39064826-39064848 GGGGAGGCCAGGTGGGGAGGTGG - Intergenic
1173572516 20:44086612-44086634 GTGGTGGTTACCTGGGGAGGTGG - Intergenic
1174497068 20:50954324-50954346 GCAGTTGCCAAGTGGGGAGGGGG + Intronic
1174571224 20:51503154-51503176 GAGGTGGCCACCTAGGTATGAGG + Intronic
1175281206 20:57805181-57805203 GAGGAGGAAAAGTGGGGAGGGGG - Intergenic
1175843906 20:62048845-62048867 GAGGTGGGCATGTGGGGAGAGGG - Intronic
1175843956 20:62048992-62049014 GAGGTGGGCATGTGGGGAGAGGG - Intronic
1176138780 20:63536177-63536199 GAGGAGGCCAGGTGAGGAGGGGG - Intronic
1176241136 20:64076489-64076511 GGGGTGCCCAGCTGGCGAGGGGG - Intronic
1176452479 21:6876521-6876543 GCGGTGGACAACTGGCCAGGAGG - Intergenic
1176830652 21:13741570-13741592 GCGGTGGACAACTGGCCAGGAGG - Intergenic
1179028995 21:37703666-37703688 GTGGTGGCCCAGTGGAGAGGGGG - Intronic
1179714190 21:43279469-43279491 GAGGTGGGGCTCTGGGGAGGTGG - Intergenic
1180103571 21:45601816-45601838 CAAGTGGCCGGCTGGGGAGGGGG - Intergenic
1180132332 21:45834723-45834745 GAGGGGGCCCACGAGGGAGGTGG + Intronic
1180997729 22:19973783-19973805 TACGTGGCCCACTGCGGAGGCGG + Exonic
1181385105 22:22538981-22539003 GGCTTGGCCAACTTGGGAGGCGG - Intergenic
1181778359 22:25175966-25175988 TTGGAGGCCAAATGGGGAGGCGG + Intronic
1181864430 22:25844099-25844121 AAGCTGGCCTCCTGGGGAGGTGG + Intronic
1182447625 22:30398624-30398646 GAGGTGGGCAACTCAGGTGGAGG - Intronic
1182453288 22:30433744-30433766 GGGGTGGCAGAGTGGGGAGGGGG - Intergenic
1182480630 22:30606707-30606729 GAGTTGGGCAGTTGGGGAGGGGG - Intronic
1183310735 22:37108265-37108287 GAGCTGGCCAGGTTGGGAGGTGG - Intronic
1183564193 22:38601428-38601450 GAGGTGGCTCACAGGGGTGGGGG + Intronic
1183990678 22:41595285-41595307 AAGGTGGCCCACTGGGCAGGAGG + Intergenic
1184121378 22:42452706-42452728 GAGCTAGCCAACTGTGGAGCTGG - Intergenic
1184514959 22:44956207-44956229 GAGGAGGCTCCCTGGGGAGGGGG + Intronic
1184665531 22:45987018-45987040 GCAGGGGCCACCTGGGGAGGAGG + Intergenic
1184722132 22:46320999-46321021 GAGGGAGCCAACACGGGAGGCGG + Intronic
1185109880 22:48894951-48894973 GAGGTGGCCACATGGGGACATGG + Intergenic
949372000 3:3345307-3345329 GAGGAGGAAAGCTGGGGAGGTGG - Intergenic
950135638 3:10578931-10578953 GCGGTGGCCTCCTGGGGAGGTGG + Intronic
950171206 3:10840169-10840191 GAGGCGGCCACATGGGGAGCAGG - Intronic
950460575 3:13119958-13119980 AAGGTGGCCAACGCTGGAGGTGG + Intergenic
951816212 3:26757820-26757842 GAATTGGCCTACTGGGGAGTTGG + Intergenic
952962854 3:38603748-38603770 GAGGTGGCTTCCTGGGGATGTGG + Exonic
953055882 3:39386903-39386925 GAGGTGGCCATCTGAGTACGTGG + Intronic
953118852 3:40019465-40019487 GAGGTGGGCAATCAGGGAGGTGG - Intronic
953957823 3:47245127-47245149 GAGGTGCCATACTGGTGAGGGGG - Intronic
956445110 3:69318448-69318470 GAGGCTGACATCTGGGGAGGGGG + Intronic
956605254 3:71067057-71067079 GGGAAGGCCCACTGGGGAGGTGG + Intronic
961381108 3:126497102-126497124 GACGTGGTCACCTGTGGAGGAGG - Intronic
962404740 3:135091269-135091291 GATGGGGCCATCTGGGCAGGTGG + Intronic
962816717 3:139006649-139006671 GAGGTGGGGAGGTGGGGAGGTGG + Intronic
962967953 3:140371530-140371552 CAGGTGGCCAACTGGAGGGCAGG - Intronic
967690751 3:192470902-192470924 GAGGTGTGAAACTGTGGAGGAGG - Intronic
968090034 3:195893810-195893832 GGGGTGGGCAGCTGGGGAGCAGG + Intronic
968324544 3:197801594-197801616 TAAGTGCCTAACTGGGGAGGAGG - Intronic
968593955 4:1473009-1473031 GAGGTGGGCAGGTGGGGAGTGGG - Intergenic
968647906 4:1749236-1749258 GAGGGGGCGCAGTGGGGAGGGGG - Intergenic
968647951 4:1749332-1749354 GAGGGGGCACAGTGGGGAGGGGG - Intergenic
968713333 4:2136782-2136804 AAGGTGCCAAACTGGGGAGGTGG + Intronic
968948091 4:3676040-3676062 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
968948095 4:3676048-3676070 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
968948099 4:3676056-3676078 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
969308648 4:6339711-6339733 GAGGTGGGAAACATGGGAGGAGG + Intronic
969617364 4:8261636-8261658 GAGGGGCCCAACTGGCCAGGTGG + Intergenic
969876525 4:10139638-10139660 GGGGTGGCCACCAGGAGAGGGGG - Intergenic
977244725 4:94618017-94618039 GAGGAAGCCAACTGCGGAGAAGG - Exonic
977294084 4:95192419-95192441 GAGGAGGTGAACAGGGGAGGAGG - Intronic
979799865 4:124894974-124894996 GAGGAGGCCTACTGGAGAGTAGG + Intergenic
979883582 4:125994303-125994325 GAGGTGGCCAGCTGGCATGGTGG + Intergenic
980937989 4:139244382-139244404 GGGGTAGCCAAATGGAGAGGTGG - Intergenic
982137002 4:152281538-152281560 TAGGCAGTCAACTGGGGAGGGGG + Intergenic
984006947 4:174323530-174323552 GAGGCAGCCAAGTGAGGAGGTGG + Intronic
984325131 4:178241818-178241840 GAGGTGGCCAAGGTGGTAGGGGG - Intergenic
985313121 4:188625591-188625613 GAGGACTCCAAGTGGGGAGGAGG - Intergenic
985536080 5:466368-466390 GAGGTGGCCCCTTGGGGAAGTGG - Intronic
985919630 5:2959828-2959850 GTGGTGGGCAGCTGGAGAGGAGG + Intergenic
986098669 5:4585252-4585274 GGGCTGGCCATCTGTGGAGGTGG + Intergenic
986753414 5:10811393-10811415 GAGCTGGCCAATTGCAGAGGTGG + Intergenic
987082884 5:14441494-14441516 GTGGTGACCACCTTGGGAGGGGG + Intronic
987438698 5:17929968-17929990 GAGGTGGCAACTTTGGGAGGTGG - Intergenic
989204170 5:38795228-38795250 GAGGTGACCAACTGGGACTGGGG + Intergenic
989585088 5:43068251-43068273 GAGGTGACCATCTTGGGAGTGGG - Intronic
992283161 5:75203226-75203248 CAGGAGGCCAAATGGGCAGGAGG + Intronic
994250919 5:97536128-97536150 AAGGTGGCCAAGTGGGCAGTAGG - Intergenic
995251712 5:110000900-110000922 AAGCTGGCCTCCTGGGGAGGAGG + Intergenic
997425640 5:133800935-133800957 GAGGTGGGGAGGTGGGGAGGTGG + Intergenic
998902002 5:146865877-146865899 GAAGTGGTTAAGTGGGGAGGTGG - Intronic
1000397194 5:160788268-160788290 CTGTTGGCCAAGTGGGGAGGAGG - Intronic
1001893217 5:175356599-175356621 GAGGAGGGGAGCTGGGGAGGCGG - Intergenic
1002076629 5:176712336-176712358 GAGGTGTCCAGCTGGCGAGGTGG - Intergenic
1002309744 5:178307121-178307143 GATGCGGCCACCTGGGGAGGGGG - Intronic
1002326073 5:178407184-178407206 GTGGAGGCCTAGTGGGGAGGTGG + Intronic
1002461449 5:179375896-179375918 GAAGTGTCCAACTGGGGGAGGGG + Intergenic
1002653659 5:180724104-180724126 GAGGTGGCCAGGTGTGGAGAAGG + Intergenic
1002881168 6:1254015-1254037 GAGGAGGCGAACTGGGCAGGGGG - Intergenic
1004708005 6:18142446-18142468 GAGGTGGGCAACTAGGAACGGGG - Intronic
1006625956 6:35397917-35397939 GAGGTGGGTAACTGGGGAGGGGG + Intronic
1007615893 6:43179662-43179684 CAGGGGGCCAGCTGGGGAGATGG + Exonic
1008949431 6:57139291-57139313 GAGGGGTACAACTTGGGAGGAGG + Intronic
1010453712 6:76030842-76030864 GAGACAGCCAAGTGGGGAGGGGG + Intronic
1012366256 6:98444247-98444269 TAGGTTGGCAACTGTGGAGGAGG - Intergenic
1013368611 6:109452561-109452583 TAGTTGGCCAGCTGGGCAGGGGG + Exonic
1013679010 6:112501973-112501995 GAGCTTGGTAACTGGGGAGGGGG - Intergenic
1018986147 6:168638578-168638600 GAGGAGCTCAGCTGGGGAGGAGG + Intronic
1019117151 6:169774424-169774446 GAGGTGGGCAGGTAGGGAGGAGG + Intronic
1019147570 6:169984884-169984906 GAGGAGGCCTCCTGGAGAGGTGG - Intergenic
1019842795 7:3465239-3465261 CAGTTGGCCAACTGGGCAGGAGG - Intronic
1019908387 7:4082129-4082151 GAGGGGGCCACCTGAGGAGGGGG + Intronic
1022017691 7:26366239-26366261 GAGAGAGCCAAATGGGGAGGAGG - Intronic
1022263847 7:28733739-28733761 GAGATGGCAAACTGGGGACACGG - Intronic
1022459766 7:30594337-30594359 AAGCTGGCGAACGGGGGAGGAGG - Intergenic
1023017534 7:35982715-35982737 GAGGTGGCCAGCGCGGGCGGGGG - Intergenic
1023330085 7:39105930-39105952 GATGTTCCCAAGTGGGGAGGTGG + Intronic
1027270166 7:76514549-76514571 AGGGTGGCCACCTGGAGAGGTGG + Intronic
1027428801 7:78088773-78088795 GAGGTGGACATCTGGGGATGGGG - Intronic
1028684219 7:93574862-93574884 GAGGGGGCTGACTGGGGTGGCGG - Intergenic
1028857743 7:95611133-95611155 GATGTGGCCAAAGGGGGAGAAGG - Intergenic
1029594504 7:101530072-101530094 GAGGTGGACAGATGGGGAGCAGG + Intronic
1029687370 7:102158015-102158037 AAGGTGGCCAACTGGAGGTGAGG - Intronic
1030656510 7:112174014-112174036 GAGGTGGGGAGGTGGGGAGGTGG - Intronic
1030656514 7:112174022-112174044 GAGGTGGGGAGGTGGGGAGGTGG - Intronic
1030673431 7:112362117-112362139 GTGGTGGCCAGGTGGGCAGGGGG - Intergenic
1032145594 7:129376916-129376938 AAGGTGGAAAGCTGGGGAGGTGG - Intronic
1033876312 7:145822817-145822839 GGGGGGCCCAACTGGGGAGTGGG + Intergenic
1034210469 7:149358386-149358408 GAGGGGGCCAAGTGGGCAGGGGG + Intergenic
1034453071 7:151148294-151148316 GAGGTGGACTCCTGGGGAGGGGG - Intergenic
1035251390 7:157599841-157599863 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251395 7:157599857-157599879 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251400 7:157599873-157599895 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251415 7:157599919-157599941 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251433 7:157599983-157600005 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251438 7:157599999-157600021 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251443 7:157600015-157600037 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251448 7:157600031-157600053 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251471 7:157600109-157600131 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251489 7:157600173-157600195 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251494 7:157600189-157600211 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035251499 7:157600205-157600227 GAGGTGGGCAGGTGGAGAGGTGG - Intronic
1035284882 7:157799749-157799771 GAGGGGGCCGGCTCGGGAGGTGG - Intronic
1035299992 7:157890989-157891011 GAGGTGGGGAGGTGGGGAGGTGG - Intronic
1035351172 7:158247340-158247362 GAGGTGGGGAAGTGGGGAGGAGG + Intronic
1035351775 7:158252383-158252405 AAGGCGGCCAACTGGGCAGCGGG + Intronic
1036899190 8:12658869-12658891 CAGCTGGCCAAAAGGGGAGGGGG - Intergenic
1037596183 8:20356231-20356253 TGGGTGGTCACCTGGGGAGGAGG - Intergenic
1038883554 8:31639866-31639888 GAGGAGGGCAAGGGGGGAGGAGG + Intronic
1041004403 8:53484828-53484850 GAGGTCGCCAGCTTGGCAGGGGG + Intergenic
1041213646 8:55578431-55578453 TATGTGACCAACTGGGGAGGGGG + Intergenic
1041957279 8:63570031-63570053 GAGGAGGCCAAGAGGAGAGGTGG - Intergenic
1042643145 8:70956690-70956712 GAGGTGGCCAAGTAGGATGGGGG + Intergenic
1043566781 8:81558004-81558026 CAGGAGGCCAGCTGGGGAAGAGG + Intergenic
1044648993 8:94474901-94474923 GAGCAGGCCAACGAGGGAGGAGG - Intronic
1045188523 8:99861587-99861609 GAGGTAAACAACTGGGGTGGTGG - Intronic
1045646598 8:104305526-104305548 GAGGTGGTCAGCTGTGGACGTGG + Intergenic
1047481082 8:125283712-125283734 GGGCTGTCCAGCTGGGGAGGGGG + Intronic
1049369585 8:142257486-142257508 GTGGTGGCCTACAGGGGAGGAGG - Intronic
1049420029 8:142512347-142512369 GAGGTGGCCTTCTGTGTAGGAGG + Intronic
1050263232 9:3863006-3863028 CAGTTGGCCAACTGCAGAGGGGG + Intronic
1051194710 9:14551311-14551333 GTGGTTGACAACTGGGGAGAGGG - Intergenic
1051746183 9:20297384-20297406 GAGGTGGCCAACAGGAAACGAGG + Intergenic
1052822014 9:33145053-33145075 TAGGTGGCCAAGTGGGAAGCTGG + Intronic
1052848008 9:33354466-33354488 GAGGTGGCCATCTCTGGAGAGGG + Intronic
1053046669 9:34926189-34926211 GAGTTGGCCAACTTGGGATCTGG + Intergenic
1056119927 9:83477561-83477583 GAGCTGGTTATCTGGGGAGGTGG - Intronic
1058467700 9:105245149-105245171 GAGGGGGCCGACTGGGGAAGGGG - Intronic
1058730663 9:107846897-107846919 GAGGTGGCCACCTGAAGAGCAGG + Intergenic
1059350397 9:113660128-113660150 GAGGAGGCTGAGTGGGGAGGAGG + Intergenic
1060002159 9:119968703-119968725 GAGGTCGCCAACTGGTGCAGAGG + Intergenic
1060942279 9:127549875-127549897 GAGGGGGCCAGAAGGGGAGGTGG + Intronic
1061407339 9:130399652-130399674 GAGGGGGACACCTGGGGTGGGGG + Intronic
1061890407 9:133616311-133616333 CAGGTGCACAACTGGGGGGGAGG + Intergenic
1062247944 9:135579194-135579216 GAGGTGGCCAAATGGCTAGATGG - Intergenic
1062288083 9:135782337-135782359 GAGGTGGACGGCAGGGGAGGTGG - Intronic
1062316197 9:135968244-135968266 GAGCTGGCCTACAGGGGTGGGGG + Intergenic
1062510403 9:136902263-136902285 GAGATGGCTCCCTGGGGAGGTGG + Intronic
1203516702 Un_GL000213v1:7994-8016 GCGGTGGACAACTGGCCAGGAGG + Intergenic
1203745440 Un_GL000218v1:38514-38536 CTGGTGGGGAACTGGGGAGGGGG + Intergenic
1186455593 X:9707775-9707797 GAGGGGGCCGACTGGAGAGGGGG - Intronic
1186578130 X:10788588-10788610 GTGGTTCCCAACTGGGGTGGGGG + Intronic
1186763823 X:12750421-12750443 GAGGTAGCCAAGTGATGAGGTGG - Intergenic
1187269304 X:17765354-17765376 GGAGTGGCCAAGTGGGGATGTGG - Intergenic
1189323322 X:40098701-40098723 GAAGGGGCAAACTGGGGTGGGGG - Intronic
1190107844 X:47572217-47572239 GAGGCAGGAAACTGGGGAGGGGG + Exonic
1190152069 X:47957205-47957227 GAGGTGGCCCGCTTGGGAGGAGG - Intronic
1190160591 X:48028944-48028966 GAGGTGGCCCGCTTGGGAAGAGG + Intronic
1191866296 X:65706455-65706477 GGGGTGGCCCCCTGGGGAGGTGG + Intronic
1192464907 X:71347887-71347909 GAGGTGGCGATGGGGGGAGGGGG - Intergenic
1195404522 X:104498145-104498167 GAGGTAGCCATTTGGGGAAGAGG - Intergenic
1196143433 X:112291185-112291207 GAGGTGTCCAAGTAGGGAGCAGG + Intergenic
1197821588 X:130546447-130546469 GTGGTGGCCAACTGAGCAGCTGG + Intergenic
1199388025 X:147246025-147246047 GTGGTGGCCCTGTGGGGAGGTGG - Intergenic
1199598939 X:149529116-149529138 GAGGTGGCCAATTAGGGAGCTGG + Intronic
1199991236 X:152988765-152988787 GAGGTGGTCTGCTGGGGATGGGG - Intergenic
1200068063 X:153514414-153514436 GAGGCGGCCAGGTGGGGCGGTGG + Intergenic