ID: 929756680

View in Genome Browser
Species Human (GRCh38)
Location 2:44771746-44771768
Sequence ACTTGACAGAAGGCAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 467
Summary {0: 1, 1: 0, 2: 8, 3: 46, 4: 412}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929756680_929756683 -4 Left 929756680 2:44771746-44771768 CCCAGCTCTGCCTTCTGTCAAGT 0: 1
1: 0
2: 8
3: 46
4: 412
Right 929756683 2:44771765-44771787 AAGTGCCTCACAGTTTATAGAGG 0: 1
1: 0
2: 1
3: 11
4: 155
929756680_929756686 13 Left 929756680 2:44771746-44771768 CCCAGCTCTGCCTTCTGTCAAGT 0: 1
1: 0
2: 8
3: 46
4: 412
Right 929756686 2:44771782-44771804 TAGAGGTCAAAGTGCAGTTTGGG 0: 1
1: 0
2: 0
3: 13
4: 164
929756680_929756685 12 Left 929756680 2:44771746-44771768 CCCAGCTCTGCCTTCTGTCAAGT 0: 1
1: 0
2: 8
3: 46
4: 412
Right 929756685 2:44771781-44771803 ATAGAGGTCAAAGTGCAGTTTGG 0: 1
1: 0
2: 1
3: 12
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929756680 Original CRISPR ACTTGACAGAAGGCAGAGCT GGG (reversed) Intronic
901007094 1:6177313-6177335 ACTTGACAGGAGGCCTGGCTAGG + Intronic
901160471 1:7173287-7173309 AATGAACAGAAGGCAGAGCGGGG + Intronic
902661374 1:17906290-17906312 ACCTAACACAAGGCAGAGTTGGG + Intergenic
902684164 1:18064981-18065003 ACATGAGAGAAGGCTGACCTGGG + Intergenic
903009945 1:20322595-20322617 AGTTGACGGGAGGCAGAGATCGG + Intronic
903926383 1:26833675-26833697 ACTTCTCAGCAGGAAGAGCTGGG - Intronic
905256847 1:36690298-36690320 AGCTGGCAGATGGCAGAGCTGGG - Intergenic
905369961 1:37477625-37477647 CCAGGACAGAAGGCAGGGCTGGG - Intronic
905688926 1:39928481-39928503 CTCTGACAGGAGGCAGAGCTCGG - Intergenic
905841725 1:41186200-41186222 ACTTGTCAGAAGTCAGAGCAAGG - Intronic
906639059 1:47430596-47430618 ATCTGACAGGAGGCGGAGCTCGG - Intergenic
907121904 1:52015414-52015436 ATCTGACAGAAGGCAGAGCTTGG + Intergenic
907616482 1:55931844-55931866 ACTTGTCAGAAAGCTGAGTTTGG - Intergenic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
907950627 1:59179763-59179785 ACATGAAGGAAGGCAGAGATTGG - Intergenic
908339788 1:63165027-63165049 ACCTGAGAGAAGGCATAGCGAGG - Intergenic
908654065 1:66369295-66369317 TCTTGAATGAAGACAGAGCTAGG - Intronic
910731843 1:90406232-90406254 ACTAGACAGACAGCAGAGGTGGG + Intergenic
911739683 1:101373781-101373803 ACTTCCCACAAGGCAAAGCTAGG + Intergenic
911783566 1:101914849-101914871 ATTTGACAGAAAGAAGAGGTTGG + Intronic
911882102 1:103252428-103252450 GCTTAACAGAAAGCACAGCTTGG - Intergenic
912932906 1:113980520-113980542 ACTCTACACAGGGCAGAGCTGGG - Exonic
913079947 1:115374380-115374402 ACATTACTGAATGCAGAGCTGGG - Intergenic
913373036 1:118121485-118121507 ATCTGACAGGAGGCAGAGCTCGG - Intronic
915341718 1:155180087-155180109 AGTTGGCAAGAGGCAGAGCTGGG - Intronic
915492708 1:156260183-156260205 CCTTTACAGAAGGCAGAGAAAGG + Intronic
915588627 1:156858625-156858647 ACTGGACACAAGCCAGGGCTGGG - Exonic
916035714 1:160920959-160920981 ACTGGATAGCAGGCAGAGGTTGG + Intergenic
916611351 1:166395128-166395150 ACATTGCAGGAGGCAGAGCTGGG + Intergenic
917027045 1:170655910-170655932 ACTTGAAATAAGGCAGATCCGGG + Intergenic
917447213 1:175116615-175116637 AACTGGCAGATGGCAGAGCTGGG + Intronic
917732122 1:177885010-177885032 AATTTACAGAAGACAGAGATGGG - Intergenic
917748783 1:178036297-178036319 ATCTGACGGGAGGCAGAGCTGGG - Intergenic
918757777 1:188358844-188358866 ACTGGGTAGCAGGCAGAGCTTGG - Intergenic
919912811 1:202122413-202122435 AGTTGATACAAGGCAGAGCAAGG - Intergenic
919996595 1:202757200-202757222 ATCTGACAGGACGCAGAGCTCGG + Intronic
920043102 1:203116569-203116591 ACGTGAGAGGAGGCAGAGCAGGG - Intronic
920441916 1:205986417-205986439 AGCTGAGAGAAGGCAGAGCTTGG + Intronic
920676057 1:208039548-208039570 TATGGACAGAAGGCAGAGCAAGG + Intronic
921279843 1:213555559-213555581 ACTACTCAGAAGGCAGAGATGGG - Intergenic
921869530 1:220124554-220124576 TCTTAACAGAAGGGAAAGCTAGG + Intronic
921900923 1:220449751-220449773 ACCTTTCAGGAGGCAGAGCTGGG - Intergenic
922388809 1:225116422-225116444 AGATGAAAGAAGGTAGAGCTTGG + Intronic
922713595 1:227852793-227852815 ACACTACAGAAGGCACAGCTTGG - Intergenic
923139947 1:231152607-231152629 ACTGGATAGCAGGCAGAGGTTGG - Intergenic
924194128 1:241587286-241587308 ATCTGACAGGAGGCGGAGCTTGG + Intronic
924305592 1:242685509-242685531 ACAAGAGAGAAGGCAGAGTTAGG + Intergenic
1063296294 10:4810101-4810123 ACTTGGCACAAAGAAGAGCTTGG - Intronic
1067036103 10:42918644-42918666 GGTTGACGGAAGGCAGAGCTTGG + Intergenic
1067432974 10:46256148-46256170 ACTTCCCAGAAGCCAGAACTAGG + Intergenic
1068001837 10:51344190-51344212 TCATGACAGAAGGCAAAGCGGGG + Intronic
1068635227 10:59341012-59341034 ACCTGACAGAGGGAAGAGGTGGG + Intronic
1068782880 10:60940856-60940878 ACTTGCCAGAAGGCTGAATTGGG - Intronic
1072601116 10:96930811-96930833 ACATGGCAGAAGGCAGAGAAGGG - Intronic
1072740400 10:97905720-97905742 ACATGACAGAAGGCAAACCGGGG + Intronic
1072909556 10:99487672-99487694 ACTAGACAAAAGGAAGAACTGGG - Intergenic
1072938273 10:99733832-99733854 CTATGACAGAAGGCAGAGCAAGG - Intronic
1072984820 10:100130435-100130457 AGTAGAAAGAGGGCAGAGCTGGG - Intergenic
1074091248 10:110258637-110258659 AGTTGTCAGAGGGCAGAGATAGG + Intronic
1074492068 10:113947301-113947323 GCTTGATAAAAGGCAGGGCTCGG - Intergenic
1074901970 10:117824757-117824779 AGGTGCCAGATGGCAGAGCTGGG + Intergenic
1076492800 10:130874709-130874731 CCTATACAGAAGGCAGATCTTGG + Intergenic
1077184194 11:1229051-1229073 AGTCCACAGAAGCCAGAGCTAGG - Intronic
1077220624 11:1413905-1413927 TCGGGGCAGAAGGCAGAGCTGGG - Intronic
1077559035 11:3245540-3245562 ATCTGACAGGAGGCAGTGCTCGG - Intergenic
1077672327 11:4167692-4167714 ACCTGACAAGAGGCACAGCTGGG - Intergenic
1078907752 11:15703562-15703584 AGTTGACATATGGCAGAGCCGGG - Intergenic
1080554033 11:33399619-33399641 AGTTGACAGCGGGCAGAGCTGGG - Intergenic
1080954528 11:37077994-37078016 ATCTGACAGGAGGCAGAGCCAGG + Intergenic
1080958742 11:37132750-37132772 ACTTATGAGAAAGCAGAGCTGGG - Intergenic
1081616006 11:44591591-44591613 ACTTCACAGAAGAAAGATCTTGG + Intronic
1081750736 11:45509088-45509110 CCTGTACAGCAGGCAGAGCTTGG + Intergenic
1081777844 11:45688453-45688475 CCTTGACAAAAGGCAGACGTTGG + Intergenic
1082842666 11:57701679-57701701 GCTTCACAGAAGGCTGAGGTGGG - Intergenic
1083344171 11:61977948-61977970 ATCTGACAGGAGGCAGAGCTGGG - Intergenic
1083593984 11:63910365-63910387 ACCTGGCAGAAGGCTGAGTTAGG + Exonic
1083635951 11:64121090-64121112 GCTAGAGAGCAGGCAGAGCTGGG + Intronic
1083854728 11:65387041-65387063 ACGGGACAGAAGGCAGTGCCGGG + Exonic
1085906738 11:80773598-80773620 ACTTGATAACAGGCAGAGGTTGG + Intergenic
1086405074 11:86492726-86492748 ACCTTACGGGAGGCAGAGCTGGG - Intronic
1088575084 11:111263811-111263833 AGTTGGCAAATGGCAGAGCTGGG - Intronic
1088596019 11:111440846-111440868 ACTCTACAGAAGTCAGAGGTGGG + Intronic
1089468944 11:118705513-118705535 ACTTGCCAGAGGGCGGAGCTTGG + Intergenic
1089837562 11:121384386-121384408 ATCTGACAGGAGGCGGAGCTCGG + Intergenic
1090033529 11:123228500-123228522 ACTTCCCAGAGGGCAGGGCTTGG - Intergenic
1090435372 11:126682764-126682786 ATCTGACAGGAGGCAGAGTTCGG + Intronic
1090735311 11:129607891-129607913 AAAGGACAGAAGGCAGAACTGGG + Intergenic
1092055902 12:5507699-5507721 ACTTGCCTGAAGGCACAGCTGGG + Intronic
1092229585 12:6769177-6769199 GGTAGACAAAAGGCAGAGCTGGG + Intronic
1092781108 12:11988285-11988307 ATCTGGCAGGAGGCAGAGCTCGG + Intergenic
1093895449 12:24569967-24569989 ACTAGACATAATGCAGAGCCTGG + Intergenic
1094029354 12:25993068-25993090 GCTTGACAAAAGTCAGGGCTTGG - Intronic
1094090674 12:26645523-26645545 ACTTCACTGAAAGCAGAGCATGG + Intronic
1094777244 12:33745075-33745097 ACTGGATAAAAGGCAGAGGTTGG + Intergenic
1096341121 12:50800571-50800593 ATTTGACAGGAGGCAGAGCTTGG - Intronic
1097264272 12:57736939-57736961 CCTTGACAGAGGGGTGAGCTTGG + Intronic
1097391096 12:59014242-59014264 AGTTGACAGAATGCTGAGCTGGG - Intergenic
1097733034 12:63151053-63151075 AGTTGAAAAAAGGCAGAGCAGGG - Intergenic
1098005765 12:65995276-65995298 ACTTGCCTGAAGGCCGAGCACGG - Intergenic
1098243692 12:68493486-68493508 AGTTGTCAGAAGGCTGAGGTGGG + Intergenic
1099089872 12:78292889-78292911 ATCTGGCAGAAGGAAGAGCTCGG - Intergenic
1099868727 12:88319306-88319328 ATCTGACAGAAGGCGGAGCTTGG - Intergenic
1101313096 12:103601622-103601644 ACATTCCAGAAGCCAGAGCTTGG - Intronic
1102217535 12:111171786-111171808 GCCGGAGAGAAGGCAGAGCTTGG + Intronic
1102547370 12:113666476-113666498 CCTTGAGAAGAGGCAGAGCTAGG - Intergenic
1104501854 12:129293754-129293776 ATCTGACAGGAGGTAGAGCTTGG + Intronic
1105679212 13:22708125-22708147 ACTTAGCATAAGGCAGGGCTGGG - Intergenic
1106433482 13:29704107-29704129 ACTTGACAAAAGGCCCAGCCAGG - Intergenic
1106714624 13:32374790-32374812 ACTAGACAACAGGCAGAGATTGG - Intronic
1108055389 13:46480011-46480033 ACATGTCAGAAGTCAGAGCCAGG + Intergenic
1108128132 13:47267406-47267428 AATTGAGAAAAGACAGAGCTGGG + Intergenic
1108377993 13:49830938-49830960 ACTTGAGAGAAGGAAGAGCTGGG - Intergenic
1109481663 13:62963602-62963624 ACTAGACAACAGGCAGAGGTTGG + Intergenic
1110758370 13:79202344-79202366 ACTTGTGAGAGGGCAGAACTCGG - Intergenic
1111034088 13:82647704-82647726 ATCTGACAGGAGGCGGAGCTAGG + Intergenic
1111201105 13:84938023-84938045 CGTTGACAGAAGGCAGATCATGG - Intergenic
1111618036 13:90686500-90686522 ACAGCACAGAAGGCAAAGCTAGG + Intergenic
1112464385 13:99630711-99630733 ATTTAAGAGAGGGCAGAGCTGGG - Intronic
1113827142 13:113265120-113265142 ACTAGACAGAAGTCAGAGCAGGG + Intronic
1114278213 14:21167248-21167270 ATCTGACAGAAGGCAGGGCTCGG + Intergenic
1114799269 14:25754582-25754604 AGAGGACAGAAGGAAGAGCTTGG - Intergenic
1115176624 14:30569364-30569386 ATTGGACACAAGGCAGAGCAAGG + Intronic
1116816411 14:49587862-49587884 ACTTGACAGAAGGGAATGCCTGG + Intronic
1117667708 14:58074614-58074636 ACATCACAGAATGCAGAGTTGGG + Intronic
1117759208 14:59009022-59009044 CCTTGACAGAAGGAAGACGTTGG + Intergenic
1119878334 14:78079112-78079134 ACTGGACACAAGGTAGAGGTGGG - Intergenic
1120236385 14:81896382-81896404 ATCTGAGAGGAGGCAGAGCTCGG + Intergenic
1120671576 14:87368395-87368417 ACCTGACAGGAGGCAGAGCTCGG + Intergenic
1120900883 14:89574549-89574571 TCTTGGCAGGGGGCAGAGCTGGG - Intronic
1121102594 14:91260278-91260300 ACTTGGCATGTGGCAGAGCTGGG - Intergenic
1121935642 14:98016160-98016182 ACTTGACAGGAAGCTGAGGTGGG - Intergenic
1202917076 14_GL000194v1_random:185256-185278 ACTTGACAGAAACAAGACCTAGG + Intergenic
1124043764 15:26128703-26128725 ACATGCCTGAAGTCAGAGCTTGG - Intergenic
1124357725 15:29009139-29009161 CCATGACAGCAGGCAGAGCTTGG + Intronic
1124848332 15:33311968-33311990 ACTTGGCTGAAGTCAGCGCTAGG - Intronic
1126898225 15:53283087-53283109 AGTTCACAGAAGGCAGAACTGGG + Intergenic
1127064268 15:55221089-55221111 ATATGACAGAAGGCAGGGTTAGG + Intronic
1128320205 15:66688125-66688147 ACTTGACAGAAGGTGGAGGGAGG + Intergenic
1129285997 15:74525485-74525507 ACTTGCCAGAGGGCAGAACAAGG + Intergenic
1132735598 16:1384342-1384364 AGTGGGCAGCAGGCAGAGCTGGG - Intronic
1133149557 16:3817482-3817504 ACTTGAGAGAAGGGGGAGTTAGG - Intronic
1133174719 16:4005517-4005539 AGTTGACAGAAGGCCGGGCATGG - Intronic
1134156363 16:11846775-11846797 ACTGCTCAGAAGGCGGAGCTTGG + Exonic
1134470064 16:14516629-14516651 ACTTGAAAGTAGGCTCAGCTAGG - Intronic
1134612407 16:15619712-15619734 ACTGCAGAGAAGGCAGAACTGGG - Intronic
1135725619 16:24851801-24851823 AGCTCACAGGAGGCAGAGCTGGG + Intronic
1135727964 16:24871829-24871851 CCATGACAGCAGGCAGATCTGGG - Intronic
1135814172 16:25616897-25616919 ACTTGACCTAAGGCAGAGCAAGG - Intergenic
1136004553 16:27319769-27319791 ACCTGACAGGTGGCCGAGCTTGG - Intronic
1137411726 16:48234175-48234197 ACTCCACTGAATGCAGAGCTGGG + Intronic
1138183644 16:54960266-54960288 AGCTGACAAATGGCAGAGCTGGG + Intergenic
1138924895 16:61579754-61579776 AGTTTACAGATGGCAGATCTTGG - Intergenic
1139218695 16:65156712-65156734 AAATAACAGAATGCAGAGCTGGG - Intergenic
1140871499 16:79110797-79110819 AGCTGATAAAAGGCAGAGCTGGG - Intronic
1141185541 16:81784438-81784460 GCTTGGCAGAAGGCTGAGCCCGG + Intronic
1141251383 16:82362090-82362112 GGTAGACAGAAGGCAGAGATGGG - Intergenic
1141799846 16:86299434-86299456 AGCTGACAAAGGGCAGAGCTGGG - Intergenic
1142612379 17:1116347-1116369 AGTTGGCAAGAGGCAGAGCTGGG - Intronic
1142765033 17:2059892-2059914 ACGGGACAGAAAGGAGAGCTGGG + Exonic
1143633183 17:8150374-8150396 TCTTGTGAGCAGGCAGAGCTGGG - Intronic
1144280448 17:13721044-13721066 AACTGACAGAAGGCAGTGATTGG - Intergenic
1145357140 17:22169176-22169198 ACTAGACAACAGGCAGAGGTTGG - Intergenic
1146544292 17:33725059-33725081 CCGTGACAGAGGGCAGAGCGAGG - Intronic
1146642325 17:34550643-34550665 ACTGGACCAAAGGCAGACCTAGG - Intergenic
1148867424 17:50635696-50635718 AGTTCAATGAAGGCAGAGCTGGG + Intronic
1149450888 17:56749168-56749190 ACTTGACAGGAAGGAGAGTTAGG - Intergenic
1149588266 17:57808169-57808191 ATCTGACAGGAGGCAGAGCTTGG - Intergenic
1150144389 17:62755436-62755458 TCTTGACAGCAGGCAGGCCTTGG + Intronic
1150366355 17:64589571-64589593 ATCTGATAGGAGGCAGAGCTCGG - Intronic
1150499148 17:65633414-65633436 ACTTCACAGAAGGCAGCCATCGG - Intronic
1150715546 17:67569864-67569886 TCTTGACTAAAGGCACAGCTTGG - Intronic
1151945468 17:77317417-77317439 ATCAGACAGGAGGCAGAGCTTGG - Intronic
1152029411 17:77832414-77832436 ATCTGAAAGGAGGCAGAGCTCGG - Intergenic
1152635578 17:81429336-81429358 ACTGAACTGAAGGCAGAGCAGGG - Intronic
1153113021 18:1616637-1616659 ACTATCCAAAAGGCAGAGCTTGG + Intergenic
1153456675 18:5290722-5290744 ACTGGACTTAAGGCAGTGCTTGG - Exonic
1153783884 18:8517282-8517304 GCTTCACAGAAGGCTGAGGTGGG + Intergenic
1155557940 18:27042452-27042474 ACCTCACTGAATGCAGAGCTGGG + Intronic
1156693469 18:39736819-39736841 TATTGACAGAAGGCAGATCATGG - Intergenic
1157600292 18:48889421-48889443 CCTTGACAGAAGGAAGAAATTGG - Intergenic
1157762125 18:50272925-50272947 GCTTCACAGAAGGCAGGCCTGGG + Exonic
1158896839 18:61922087-61922109 ATCTGACAGGAGGCGGAGCTCGG - Intergenic
1158909534 18:62046398-62046420 ATCTGACAGGAGGCGGAGCTCGG - Intronic
1159149824 18:64506128-64506150 ACTGTACAGAAAGCATAGCTGGG - Intergenic
1161214736 19:3088563-3088585 ACGTGACAGGAGGGAGGGCTTGG + Intergenic
1161922446 19:7276641-7276663 AGTTGACAGGTGACAGAGCTGGG - Intronic
1163065251 19:14787537-14787559 AATTGGAAGAATGCAGAGCTTGG + Intergenic
1163161975 19:15470169-15470191 GCTTGAGAAAAGGCAGAGGTGGG - Intronic
1165898369 19:39156539-39156561 CCTGGACAGAGGGCAGGGCTGGG - Intronic
1166206185 19:41270926-41270948 GCTTGTCCGATGGCAGAGCTGGG + Intronic
1166517302 19:43456950-43456972 TTTTAACAGAAAGCAGAGCTAGG + Intergenic
1166998087 19:46729367-46729389 AGTTCACAGTGGGCAGAGCTTGG - Intronic
925439482 2:3872063-3872085 ATCTGACAGGAGGCAGAGCTCGG + Intergenic
925715095 2:6776704-6776726 ATCTGACAGAAGGCAGACCTCGG - Intergenic
925875989 2:8311652-8311674 ACTTCACTGAACGCAGAGTTGGG + Intergenic
928271167 2:29856241-29856263 ACTTTACAGATGAGAGAGCTAGG - Intronic
928345212 2:30487224-30487246 ACTTGAAAGAATGCAAAGTTGGG + Intronic
928363979 2:30687678-30687700 GCTTGACTGTAGGCAGATCTGGG - Intergenic
929264265 2:39900549-39900571 GCTTAACAGAAAGCACAGCTAGG - Intergenic
929756680 2:44771746-44771768 ACTTGACAGAAGGCAGAGCTGGG - Intronic
931117472 2:59180307-59180329 CCTTGAAAGAAAGCAGCGCTGGG + Intergenic
931495702 2:62804790-62804812 ATTTGACAGGAGGCAAAGCTCGG - Intronic
932228163 2:70059816-70059838 ATCTGACAGGAGGCACAGCTCGG + Intergenic
932976277 2:76603180-76603202 ACTGGATAGCAGGCAGAGATTGG - Intergenic
934515819 2:94985764-94985786 CCTTGCCACCAGGCAGAGCTGGG + Intergenic
934885818 2:98023345-98023367 ATCTGACAGGAGGCAAAGCTGGG - Intergenic
935178331 2:100668805-100668827 CCTTGGCAGGATGCAGAGCTAGG - Intergenic
935528324 2:104200505-104200527 CCTTTACATAATGCAGAGCTTGG - Intergenic
936230283 2:110694511-110694533 GCTTGGGAGAAGGCAGAGGTGGG + Intergenic
936522336 2:113219206-113219228 ACTTGAAAGGTGGCAGACCTGGG - Intronic
936904416 2:117520478-117520500 ACTTGCCAGAAGGCATAGACTGG - Intergenic
937241392 2:120464773-120464795 CCTTGACAGAAGCCAGGGCACGG - Intergenic
937419473 2:121741971-121741993 ACTTCACACAGGGCAGAGCATGG - Intronic
938932569 2:136099668-136099690 ATGTGACAGCAGGCAGAGATGGG - Intergenic
939034011 2:137109683-137109705 ATCTAACAGGAGGCAGAGCTCGG + Intronic
940312346 2:152291953-152291975 ATCTGACAAGAGGCAGAGCTCGG - Intergenic
941077236 2:161019816-161019838 AAGTGACTGAATGCAGAGCTGGG - Intergenic
941827950 2:169920773-169920795 ACTTGACTGGAGGCAGGGCAGGG - Intronic
942424588 2:175846276-175846298 ACATGACAGGAGGCAGGGCAGGG - Intergenic
943365822 2:186966793-186966815 CCTTGACAATTGGCAGAGCTGGG - Intergenic
944896208 2:204167891-204167913 ATCTGACAGGAGGCAGAGCCAGG - Intergenic
946308167 2:218867949-218867971 AGTTGACAGAAACCAGAGATCGG + Intronic
946562575 2:220929070-220929092 ACTGGATAAAAGGCAGAGGTTGG - Intergenic
947090966 2:226511008-226511030 ACTGGACAGAAGGAAAAGCTGGG + Intergenic
947201745 2:227620408-227620430 ATCTGACAGGAGGCGGAGCTTGG - Intronic
947856533 2:233328179-233328201 TGCTGACAGGAGGCAGAGCTGGG + Intronic
948149385 2:235733012-235733034 ACTAGACGGATGGCAGAGCATGG - Intronic
948619866 2:239227551-239227573 TCATCACAGAAGGCAGAGCCTGG + Intronic
948997097 2:241587040-241587062 ACTTGAAAGCAGCCAGAGGTGGG + Intronic
1168784045 20:522063-522085 ATGGGACAGGAGGCAGAGCTCGG - Intronic
1168819462 20:763343-763365 AGCTGACAGGTGGCAGAGCTGGG + Intronic
1169204386 20:3732092-3732114 ACTTGAGCAAAGACAGAGCTAGG + Intergenic
1172074235 20:32281822-32281844 ACATGTCAGAAGGAAGAGCAAGG + Intronic
1172896234 20:38302186-38302208 ACTTGGAAAAAGGGAGAGCTGGG + Intronic
1173307552 20:41864354-41864376 ACTAGTCAGCAGGCAGAGCTAGG - Intergenic
1173324226 20:42018112-42018134 GCTTGACAGAAGACAGAGGAAGG - Intergenic
1173379029 20:42520774-42520796 GCTTGTCAGCAGACAGAGCTTGG + Intronic
1173648235 20:44646856-44646878 ACTTGAGTGCAGGCAGATCTGGG + Intronic
1173792173 20:45834645-45834667 ACTTGACACAAGGGAAAACTTGG - Intronic
1174362532 20:50037946-50037968 ACTTAACAGGGGGCTGAGCTGGG - Intergenic
1174858731 20:54070311-54070333 AGTGAACAGAAGGCAGAGCTGGG + Intronic
1175324954 20:58117589-58117611 TTTTGAAAGAAGGCAGAGATGGG + Intergenic
1175804030 20:61817382-61817404 ACTGGGAACAAGGCAGAGCTCGG - Intronic
1177600056 21:23299208-23299230 ATCTGACAGGAGGCGGAGCTTGG - Intergenic
1177866548 21:26519408-26519430 ACCAGACAGATGGCACAGCTAGG + Intronic
1178180928 21:30160612-30160634 ACTTGGCAAAAGGCAGAACCTGG + Intergenic
1178357580 21:31921512-31921534 ACATGCCAGGAGGGAGAGCTGGG + Intronic
1178635684 21:34300389-34300411 AGTTGACAAATGGAAGAGCTAGG + Intergenic
1178640534 21:34341863-34341885 ACTACTCAGAAGGCTGAGCTGGG + Intergenic
1179463338 21:41552986-41553008 ACTTGAGACAACTCAGAGCTTGG - Intergenic
1179553664 21:42159368-42159390 TCTTGACTGAATACAGAGCTAGG + Intergenic
1179990289 21:44944717-44944739 GCTTCACAGTCGGCAGAGCTGGG + Intronic
1180112017 21:45663076-45663098 TGTTGTCAGAAGGCAGAGCCAGG - Intronic
1180733241 22:17997671-17997693 CCTTGACTGAAAGCAGGGCTGGG - Intronic
1182859675 22:33548278-33548300 TCATGGCAGAAGGCAGAGCGGGG - Intronic
1183286756 22:36970963-36970985 AGTTGACTGAAGGCAGAGACAGG - Intergenic
1183908094 22:41058053-41058075 ACCTCCCAGAAGGCAGAGCTAGG + Intergenic
1183963903 22:41429701-41429723 CCTTGGCAGAGGGCAGGGCTGGG + Intergenic
1184471117 22:44697046-44697068 ACATATCAGATGGCAGAGCTAGG + Intronic
1185037646 22:48488378-48488400 ACCTGCAGGAAGGCAGAGCTTGG + Intergenic
1185116776 22:48942350-48942372 AATTCAGAGAAGGCAGAGCAGGG - Intergenic
1185129293 22:49028542-49028564 ACTTCACAGAGGACAGAGCAGGG + Intergenic
949442252 3:4094586-4094608 GCTTGACAAAAGGCATAACTGGG - Intronic
950863565 3:16171459-16171481 AGTTGAGAGAAGGCAGAGGAGGG + Intergenic
952365544 3:32671674-32671696 ATCTGACAGGAGGCGGAGCTCGG + Intergenic
952384296 3:32828617-32828639 CCTTCTCAGAAGGCAGAGGTGGG - Intronic
953933231 3:47017518-47017540 TCTTGTCAGATGTCAGAGCTGGG - Intronic
954592220 3:51792648-51792670 ATCTGACAAGAGGCAGAGCTCGG + Intergenic
956153784 3:66272199-66272221 ACTTGACAGAAACTAAAGCTTGG + Intronic
956211387 3:66805004-66805026 ACCTTACAGATGGCAGATCTTGG - Intergenic
957003521 3:74915444-74915466 GCTTGACAGAAGGCAAATATGGG - Intergenic
957623475 3:82625873-82625895 ACTTTTCAGAAGGCAGAGCTAGG + Intergenic
957871909 3:86099869-86099891 AGCTAACAAAAGGCAGAGCTGGG - Intergenic
958712027 3:97728718-97728740 ACTTGCCCAAAGGCAGAGCTTGG + Intronic
959085492 3:101848030-101848052 AATTGACAGAAAGCAGAGCTGGG - Intronic
959272506 3:104231036-104231058 AGGTGACAGAAGACAGAACTTGG + Intergenic
959833419 3:110891403-110891425 ACCTTTCAGAAGGGAGAGCTAGG + Intronic
960486409 3:118258538-118258560 ACTGGACAACAGGCAGAGGTTGG + Intergenic
962855220 3:139339182-139339204 ACCTGACAGCAGCCAGATCTTGG + Intronic
962943915 3:140150434-140150456 ACTTTAGTGAAGGGAGAGCTGGG - Intronic
963414323 3:144975228-144975250 ACTTTACAGAAGACAGAGAGTGG - Intergenic
964090640 3:152872293-152872315 ACATCACTGAAGGCAGAGTTGGG - Intergenic
964975975 3:162621190-162621212 ATCTGACAGGAGGCAAAGCTCGG - Intergenic
965398900 3:168194556-168194578 ACCTGGCATATGGCAGAGCTGGG + Intergenic
965732155 3:171783540-171783562 AGTTGGCAGATGGTAGAGCTGGG + Intronic
965935227 3:174101030-174101052 AGTTGACAGAAGGCAGACATGGG - Intronic
966437838 3:179908416-179908438 AGTTTATAAAAGGCAGAGCTGGG - Intronic
966446685 3:180008448-180008470 ACTTGGAAGCAGGCAGAGGTTGG - Intronic
966591605 3:181689813-181689835 ATTTGCTAGAAGTCAGAGCTAGG - Intergenic
966924786 3:184637192-184637214 AGATGACAGGAGGCAGAGCTGGG + Intronic
966935987 3:184709843-184709865 ACTTGATACATGGCAGATCTGGG - Intergenic
967214280 3:187197417-187197439 GGTTGCCAGAAGACAGAGCTTGG - Intergenic
967621866 3:191643015-191643037 ACTTGAAGGACAGCAGAGCTGGG - Intergenic
968205513 3:196796071-196796093 ATCTGACAGGAGGCGGAGCTCGG + Intronic
968331499 3:197874280-197874302 ATCTGACAGGAGGCAGAGCTCGG - Intronic
969217695 4:5735253-5735275 ACCTGAGGGAATGCAGAGCTGGG + Intronic
969338814 4:6527845-6527867 CCTGGACAGAAGGCAGGGCCTGG + Intronic
970303280 4:14703689-14703711 CCCTGAAAAAAGGCAGAGCTTGG + Intergenic
970933004 4:21535512-21535534 TCTTTACAGAAGGGAGAGTTTGG - Intronic
972799001 4:42453080-42453102 ATTTGACAGAAAGCACAGGTGGG + Intronic
974177568 4:58344241-58344263 ACTAGATAGCAGGCAGAGGTTGG + Intergenic
975646920 4:76554873-76554895 ATCTTACAGGAGGCAGAGCTCGG - Intronic
975701570 4:77072325-77072347 ACAGGACAGAAGGCAGGGCATGG + Intronic
975932102 4:79537576-79537598 ATCTGACAGGAGGCGGAGCTCGG - Intergenic
975961955 4:79920098-79920120 CCTTTCCAGCAGGCAGAGCTAGG - Intronic
976398987 4:84586524-84586546 ATCTGACAGGAGGCAGCGCTCGG + Intronic
976705616 4:88016106-88016128 ATCTGACAGGAGGCGGAGCTCGG + Intronic
978209338 4:106116666-106116688 ATCTGACAGGAGGCGGAGCTCGG - Intronic
978811752 4:112856978-112857000 ACTTTGCAGAAGGCAGGGCAAGG + Intronic
979377236 4:119961725-119961747 GCTTCACAGAAAGCATAGCTGGG + Intergenic
981566619 4:146108342-146108364 ATGTGACAGAAGGCAGACCCAGG + Intergenic
983637691 4:169914756-169914778 ACCTGGCAGGGGGCAGAGCTTGG + Intergenic
984042781 4:174757301-174757323 GCTTCACAGCAGACAGAGCTTGG - Intronic
984131369 4:175879243-175879265 ACTGGACAACAGGCAGAGGTTGG - Intronic
984941760 4:184938956-184938978 ATTCGACAGGAGGCTGAGCTCGG + Intergenic
985388372 4:189468462-189468484 TCCTGACAGAAGGGACAGCTGGG + Intergenic
986291334 5:6401544-6401566 CCTGGACAGCAGCCAGAGCTGGG - Intergenic
986846516 5:11762758-11762780 ACTAGACAGAAGGCAGTACTGGG - Intronic
987155158 5:15081688-15081710 TCTTGACAGATTGCAGTGCTTGG + Intergenic
988180809 5:27789205-27789227 ACTTAATAGAAGGCAGTGCTTGG - Intergenic
988596301 5:32594645-32594667 ATCTGACAGGAGGCAGAGCTCGG - Intronic
991482530 5:67097063-67097085 ACTTGACTGAAGGCAATGCAAGG - Intronic
991661732 5:68957707-68957729 ACTTGACAGATGGGAGGGCATGG - Intergenic
993117419 5:83734696-83734718 ACTGGGCAGCAGGCAGAGGTTGG + Intergenic
994812093 5:104532938-104532960 ACTTGGAGGAAGGCAGAGCGGGG + Intergenic
995083457 5:108081066-108081088 ACATGACAGATAGCAGGGCTTGG - Intronic
995357132 5:111251522-111251544 GCTGGAAGGAAGGCAGAGCTGGG + Intronic
996118233 5:119642692-119642714 AGTTCTCAGAAGGCAGAGCCAGG - Intergenic
996432231 5:123394467-123394489 ATCTGATAGGAGGCAGAGCTCGG + Intronic
996567718 5:124897597-124897619 ACCTGACAGGAGGCATAGCTAGG - Intergenic
997427000 5:133810100-133810122 TCTTGACAGCAGGGAGAGCCTGG + Intergenic
997757889 5:136417273-136417295 ACTTGGGAGCAGGCAGAGCTGGG + Intergenic
998135047 5:139670058-139670080 CCTTGACAGATGCCACAGCTGGG - Intronic
998677514 5:144426171-144426193 GCTTGATAGAATGCAGAACTTGG - Intronic
999269032 5:150285685-150285707 AATTGACTCAAGGCAGAGCTGGG - Intronic
999564465 5:152841896-152841918 ACTTCACAGTGGGCAGTGCTAGG - Intergenic
1001753921 5:174151778-174151800 AGCTGACTGAAGGCAGAGCAGGG - Intronic
1001854659 5:175000459-175000481 ATCTGACAGGAGGCGGAGCTCGG + Intergenic
1002076305 5:176710529-176710551 TCTGGACAGAGGGCACAGCTGGG - Intergenic
1002090084 5:176799187-176799209 ACCTCAGAGAAGGCAGAGCCCGG + Intergenic
1003728949 6:8799035-8799057 ACATGACAGGAGGCAGGGCAGGG + Intergenic
1003864630 6:10351760-10351782 ACTTGACAAAAGGCCGAGCTTGG - Intergenic
1004415843 6:15423440-15423462 ACATCACAGAAGGAAGAGTTTGG + Intronic
1004589261 6:17032689-17032711 CCTTGAGGGAAGGCAAAGCTGGG - Intergenic
1004675166 6:17834769-17834791 ACAAGAAAGATGGCAGAGCTTGG + Intronic
1004952382 6:20688134-20688156 ACCTGAAAGAAGCCAGAGGTGGG - Intronic
1004982321 6:21039134-21039156 ATCTGAGAGAAGGCGGAGCTTGG - Intronic
1005260142 6:24050204-24050226 ATCCGACAGGAGGCAGAGCTTGG - Intergenic
1005843500 6:29759962-29759984 ACAGGAAAGAAGGCAGAGGTGGG - Intergenic
1006181473 6:32155701-32155723 CCATGACAGAAAGCAGAGCCCGG - Exonic
1006406453 6:33848538-33848560 TCTGGACAGGAGGGAGAGCTGGG - Intergenic
1006635440 6:35458203-35458225 ACTGGACAGCAGACAGAGCAGGG - Intronic
1007605437 6:43114538-43114560 ACTTGAGTGAAGCCAGATCTCGG + Intronic
1009621804 6:66087086-66087108 ACTTTACAGGAGGCAGCCCTCGG - Intergenic
1009921662 6:70069330-70069352 ATTTTACAGAAGGCAGAACTGGG - Intronic
1009965400 6:70573084-70573106 ACTTGGCAGAAGGCTGAGGCGGG - Intronic
1011035839 6:82973830-82973852 ATCTCACAGGAGGCAGAGCTTGG - Intronic
1012500568 6:99883553-99883575 ACTTGACAGAAGGGGTAGGTGGG + Intergenic
1014631994 6:123799823-123799845 AGTTGATAAATGGCAGAGCTTGG + Intergenic
1014771400 6:125461813-125461835 ACTTGAAAGAAGCCAGAGGTGGG - Intergenic
1015858347 6:137649477-137649499 AATTGACTGAAGGCCGAGGTGGG - Intergenic
1017781109 6:157716075-157716097 GCTTAACTGAAGCCAGAGCTGGG + Intronic
1018068763 6:160142574-160142596 CCTTAACAGAAGGCTCAGCTTGG + Intronic
1018100158 6:160430894-160430916 TCATGACAGAAAGCAGATCTGGG + Intronic
1018153783 6:160965816-160965838 ACCTGACAGAAGGCAGGTCAGGG - Intergenic
1018270342 6:162070792-162070814 ATTTGACAGGAGGTGGAGCTCGG + Intronic
1018507206 6:164484203-164484225 ACTGGATAAAAGGCAGAGATTGG - Intergenic
1018848008 6:167568477-167568499 AATGGTAAGAAGGCAGAGCTTGG - Intergenic
1019120696 6:169801482-169801504 GGTGGACAGGAGGCAGAGCTCGG + Intergenic
1019764496 7:2840289-2840311 AATTAGCAGATGGCAGAGCTAGG - Intronic
1019886842 7:3912753-3912775 AGTTGACAGAAGGAAGAGGAAGG + Intronic
1020187689 7:5971411-5971433 ATGTGACAGGAGGCGGAGCTCGG + Intergenic
1020290722 7:6720521-6720543 ACTTGACAAAGGTCAGTGCTTGG - Intergenic
1020295228 7:6753359-6753381 ATGTGACAGGAGGCGGAGCTCGG - Intergenic
1021525099 7:21578001-21578023 ACTTAACAGAAAGCATAACTGGG + Intronic
1021695385 7:23271209-23271231 AGATGACAGGAGGCAGAGCTTGG + Intronic
1021953455 7:25798225-25798247 ACTGGACAGAAGGCAGATGCTGG - Intergenic
1023020942 7:36011246-36011268 ACTTCCCAGAGGGCAGAGCCAGG - Intergenic
1023277512 7:38535806-38535828 ATCTGACAGGAGGCGGAGCTCGG + Intronic
1024289692 7:47793701-47793723 ACTTGATAACAGGCAGAGGTTGG + Intronic
1024322039 7:48080138-48080160 ATCTGACAGAAGGCAGAGCTTGG - Intergenic
1025746369 7:64246426-64246448 ACAAGAAAGAATGCAGAGCTGGG + Intronic
1026129113 7:67605873-67605895 TCATGACAGAAGGCACAGCCAGG + Intergenic
1026291447 7:69010006-69010028 ACTTAAAAGTAGGCACAGCTGGG - Intergenic
1026565049 7:71482926-71482948 ATCTGACAGGAGGCAGAGCTCGG + Intronic
1026827167 7:73591658-73591680 AGTTGGAAGAAGGCAGAGCTGGG - Intergenic
1026869788 7:73843235-73843257 ATTTGCCAGGAGGCAGAGGTGGG - Intergenic
1028814551 7:95129580-95129602 ACTGGACAACAGGCAGAGGTTGG + Intronic
1029311768 7:99673827-99673849 ACTGGACAGAAGGCGATGCTGGG + Intronic
1030779927 7:113587699-113587721 ACTTTACGGAAGGAAGAGTTGGG - Intergenic
1031480552 7:122273649-122273671 ACTTGACAAAGGGCAGTGCCAGG - Intergenic
1032428882 7:131844421-131844443 GCTTGACAGAGGACAGTGCTGGG + Intergenic
1032438226 7:131920026-131920048 ATCTGACAGGAGGCAGAGCTTGG + Intergenic
1033032341 7:137839169-137839191 AGCAGACAGAAGGCAGAGGTCGG - Intronic
1033481527 7:141746451-141746473 ACTTGGGAGAAGGCTGAGGTGGG - Intronic
1033510893 7:142059330-142059352 ACCTAACAAATGGCAGAGCTGGG + Intronic
1033513703 7:142085691-142085713 ACCTAACAAATGGCAGAGCTCGG + Intronic
1033648355 7:143321858-143321880 GCATGACTGAAGCCAGAGCTGGG + Intronic
1034234777 7:149558102-149558124 ACTTAACAGAAGGGAGAACCTGG - Intergenic
1035001324 7:155614781-155614803 ATCTGACAGGAGGCGGAGCTCGG + Intronic
1036477446 8:9106004-9106026 ATCTGACAGGAGGCAGAGCTCGG - Intronic
1037657628 8:20899184-20899206 ACTTGAAAGCAGTCAGAGCCAGG - Intergenic
1037897759 8:22669375-22669397 ACTTGACAGAGGGGACAGCCCGG - Intergenic
1037953989 8:23039184-23039206 ATTTGACGGCATGCAGAGCTCGG + Intronic
1038126177 8:24675302-24675324 ATTTGACAGAAAGAAGAGCTTGG - Intergenic
1038141266 8:24847961-24847983 AGCTGTGAGAAGGCAGAGCTGGG + Intergenic
1038523253 8:28251594-28251616 ATCTGACAGGAGGCAGAGCTTGG + Intergenic
1041141714 8:54827436-54827458 ACTTGGGAGAAGGCTGAGGTGGG - Intergenic
1041836345 8:62220185-62220207 AGATGACAGCAGGCAGAGATGGG + Intergenic
1042265932 8:66909385-66909407 ACTTGACAACAGGCAGAGGGTGG + Intronic
1043979151 8:86618145-86618167 ATCTGACAGGAGGCGGAGCTTGG + Intronic
1044323309 8:90830874-90830896 ACTTGAGAGAAGTCACAGCAGGG + Intronic
1044764887 8:95560872-95560894 ACTTAGCAGAAGGCATATCTAGG - Intergenic
1045880239 8:107029824-107029846 ACTTGATAAGAGGCAGAGGTTGG + Intergenic
1046819078 8:118616820-118616842 ATCTGACAGGAGGTAGAGCTTGG - Intronic
1047089547 8:121558493-121558515 AGTTTACAGAAGGCAGTGATAGG - Intergenic
1047297670 8:123585673-123585695 ACATCACTGAAAGCAGAGCTGGG - Intergenic
1047713026 8:127570623-127570645 CCCTGACATAAGGCAGAGCACGG - Intergenic
1047937856 8:129799649-129799671 ACTTCACAGGAGGCATGGCTAGG + Intergenic
1048383344 8:133888213-133888235 ATCTGACAGGAGGCAGAGCTCGG + Intergenic
1048842350 8:138577135-138577157 ACTTAACTGGAGCCAGAGCTTGG + Intergenic
1049558361 8:143295099-143295121 GACAGACAGAAGGCAGAGCTGGG + Intronic
1050238792 9:3612711-3612733 ACTTCCCTGAAGGGAGAGCTAGG - Intergenic
1050607548 9:7317247-7317269 ATTTGAAAGAAGTCAGAGATCGG - Intergenic
1050669336 9:7978659-7978681 ACATGGGAGAAGGCACAGCTAGG + Intergenic
1050689593 9:8210405-8210427 ACAGGAAAGAAGGAAGAGCTCGG + Intergenic
1050780935 9:9334465-9334487 ACTTGACAGATGGAAAAGTTAGG - Intronic
1051487983 9:17629149-17629171 ACTTCATGGAAGGCAGAACTGGG - Intronic
1051556321 9:18386569-18386591 ACTTGACAGAAGGTTTACCTGGG + Intergenic
1051895973 9:21989693-21989715 ACATGACAGAAGGCAACTCTGGG - Intronic
1051975534 9:22943053-22943075 ACTGGGTAGCAGGCAGAGCTTGG - Intergenic
1053383797 9:37670712-37670734 ACTTTACTGAAAGCACAGCTTGG - Intronic
1053386409 9:37694017-37694039 ACCTCACAGAAGGCAGGTCTAGG - Intronic
1054797280 9:69314180-69314202 ACTATACAGGAGGCATAGCTGGG + Intergenic
1054877639 9:70113206-70113228 TGTTGACAGAAGCCACAGCTAGG - Intronic
1055841199 9:80506319-80506341 ACTTCACTGAATACAGAGCTGGG - Intergenic
1056205297 9:84314000-84314022 ACTTTCCAATAGGCAGAGCTGGG + Intronic
1057942629 9:99298277-99298299 ACTTAAAAGGAGGCAGAGTTTGG - Intergenic
1058068105 9:100571946-100571968 ATCTGACAGGAGGCGGAGCTTGG + Intronic
1058809163 9:108622562-108622584 ACTTTAAAGAAAGCAGAACTTGG + Intergenic
1059366069 9:113787370-113787392 AGTTGACAGAGGGCTGAGCTGGG + Intergenic
1059467510 9:114478425-114478447 ACTTGAGGGAAGACAGAGCCTGG + Intronic
1060563937 9:124572140-124572162 ACGAGGCAAAAGGCAGAGCTGGG + Intronic
1061133144 9:128719487-128719509 AGGTCACAGAAGGCAGAACTCGG - Intronic
1061283245 9:129609307-129609329 CCAAGGCAGAAGGCAGAGCTGGG - Intronic
1061431952 9:130536700-130536722 ACAGGTCAAAAGGCAGAGCTGGG - Intergenic
1061443563 9:130624243-130624265 ACATGACTGATGGCAGAGCTGGG - Intronic
1062333812 9:136056224-136056246 AAATGCCAGAAAGCAGAGCTGGG + Intronic
1062443009 9:136579447-136579469 GCCTGGCCGAAGGCAGAGCTGGG - Intergenic
1062453097 9:136623684-136623706 TCAGGACAGGAGGCAGAGCTGGG - Intergenic
1187022020 X:15393591-15393613 ATCTGACAGGAGGCAGAGCTGGG - Intronic
1188117909 X:26267783-26267805 ACCTTGCAGAAGTCAGAGCTGGG + Intergenic
1188174986 X:26977953-26977975 ATCTGACAGGAGGTAGAGCTCGG + Intergenic
1189133768 X:38528061-38528083 GCTTAACAGAAGGCAGAGGCTGG + Intronic
1191594584 X:62929105-62929127 ACATGACAGGTGGCAGGGCTGGG - Intergenic
1192505757 X:71681172-71681194 ACATCACAGAAGTCAGAACTTGG - Intergenic
1193225068 X:78972776-78972798 ATTTGATAACAGGCAGAGCTTGG - Intergenic
1193285089 X:79703761-79703783 ACTTCACAGAAGGCAGAAAAAGG + Intergenic
1193354187 X:80498007-80498029 ACTTGACAAAAGCAAGAACTGGG - Intergenic
1193929993 X:87541786-87541808 ACTTGGTAACAGGCAGAGCTTGG + Intronic
1194374083 X:93111048-93111070 ACTTGGCAGCTGGCAGAGGTTGG - Intergenic
1195498195 X:105562678-105562700 GCTTGCCAGAAGGCTTAGCTTGG + Intronic
1195704568 X:107729629-107729651 CCCTGACACCAGGCAGAGCTGGG + Intronic
1196230807 X:113218611-113218633 ACTTTACAGATGACAGAACTGGG - Intergenic
1197411235 X:126118893-126118915 ACTGGATAGCAGGCAGAGGTTGG + Intergenic
1197654842 X:129105866-129105888 ATCTGACAGGAGGCGGAGCTTGG + Intergenic
1200381504 X:155842250-155842272 ACTTGATAACAGGCAGAGGTTGG + Intergenic