ID: 929758728

View in Genome Browser
Species Human (GRCh38)
Location 2:44788811-44788833
Sequence GAATCAGATGTGCCTGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929758728_929758729 -3 Left 929758728 2:44788811-44788833 CCAGATGCAGGCACATCTGATTC No data
Right 929758729 2:44788831-44788853 TTCTCAGCCACCATCTAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929758728 Original CRISPR GAATCAGATGTGCCTGCATC TGG (reversed) Intergenic
No off target data available for this crispr