ID: 929761799

View in Genome Browser
Species Human (GRCh38)
Location 2:44813391-44813413
Sequence TGTCCCAAATAGCCACAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929761799_929761802 1 Left 929761799 2:44813391-44813413 CCTGCTTGTGGCTATTTGGGACA No data
Right 929761802 2:44813415-44813437 TCCCTGAAGGCTGACACACAGGG No data
929761799_929761801 0 Left 929761799 2:44813391-44813413 CCTGCTTGTGGCTATTTGGGACA No data
Right 929761801 2:44813414-44813436 TTCCCTGAAGGCTGACACACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929761799 Original CRISPR TGTCCCAAATAGCCACAAGC AGG (reversed) Intergenic
No off target data available for this crispr