ID: 929762084 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:44815101-44815123 |
| Sequence | CTAATGGGGCAAGGGCTGTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 929762084_929762097 | 3 | Left | 929762084 | 2:44815101-44815123 | CCCCACAGCCCTTGCCCCATTAG | No data | ||
| Right | 929762097 | 2:44815127-44815149 | GGGCCTCCTGGTAGACACACAGG | No data | ||||
| 929762084_929762094 | -9 | Left | 929762084 | 2:44815101-44815123 | CCCCACAGCCCTTGCCCCATTAG | No data | ||
| Right | 929762094 | 2:44815115-44815137 | CCCCATTAGGAGGGGCCTCCTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 929762084 | Original CRISPR | CTAATGGGGCAAGGGCTGTG GGG (reversed) | Intergenic | ||