ID: 929762085 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:44815102-44815124 |
Sequence | CCTAATGGGGCAAGGGCTGT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
929762085_929762094 | -10 | Left | 929762085 | 2:44815102-44815124 | CCCACAGCCCTTGCCCCATTAGG | No data | ||
Right | 929762094 | 2:44815115-44815137 | CCCCATTAGGAGGGGCCTCCTGG | No data | ||||
929762085_929762097 | 2 | Left | 929762085 | 2:44815102-44815124 | CCCACAGCCCTTGCCCCATTAGG | No data | ||
Right | 929762097 | 2:44815127-44815149 | GGGCCTCCTGGTAGACACACAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
929762085 | Original CRISPR | CCTAATGGGGCAAGGGCTGT GGG (reversed) | Intergenic | ||