ID: 929762092

View in Genome Browser
Species Human (GRCh38)
Location 2:44815110-44815132
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929762092_929762101 27 Left 929762092 2:44815110-44815132 CCTTGCCCCATTAGGAGGGGCCT No data
Right 929762101 2:44815160-44815182 AGACTTCTGAACCCTCAGGAAGG No data
929762092_929762097 -6 Left 929762092 2:44815110-44815132 CCTTGCCCCATTAGGAGGGGCCT No data
Right 929762097 2:44815127-44815149 GGGCCTCCTGGTAGACACACAGG No data
929762092_929762100 23 Left 929762092 2:44815110-44815132 CCTTGCCCCATTAGGAGGGGCCT No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762092_929762102 28 Left 929762092 2:44815110-44815132 CCTTGCCCCATTAGGAGGGGCCT No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929762092 Original CRISPR AGGCCCCTCCTAATGGGGCA AGG (reversed) Intergenic