ID: 929762093

View in Genome Browser
Species Human (GRCh38)
Location 2:44815115-44815137
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929762093_929762102 23 Left 929762093 2:44815115-44815137 CCCCATTAGGAGGGGCCTCCTGG No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data
929762093_929762100 18 Left 929762093 2:44815115-44815137 CCCCATTAGGAGGGGCCTCCTGG No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762093_929762101 22 Left 929762093 2:44815115-44815137 CCCCATTAGGAGGGGCCTCCTGG No data
Right 929762101 2:44815160-44815182 AGACTTCTGAACCCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929762093 Original CRISPR CCAGGAGGCCCCTCCTAATG GGG (reversed) Intergenic