ID: 929762095

View in Genome Browser
Species Human (GRCh38)
Location 2:44815116-44815138
Sequence ACCAGGAGGCCCCTCCTAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929762095_929762100 17 Left 929762095 2:44815116-44815138 CCCATTAGGAGGGGCCTCCTGGT No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762095_929762101 21 Left 929762095 2:44815116-44815138 CCCATTAGGAGGGGCCTCCTGGT No data
Right 929762101 2:44815160-44815182 AGACTTCTGAACCCTCAGGAAGG No data
929762095_929762102 22 Left 929762095 2:44815116-44815138 CCCATTAGGAGGGGCCTCCTGGT No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929762095 Original CRISPR ACCAGGAGGCCCCTCCTAAT GGG (reversed) Intergenic
No off target data available for this crispr