ID: 929762096

View in Genome Browser
Species Human (GRCh38)
Location 2:44815117-44815139
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929762096_929762100 16 Left 929762096 2:44815117-44815139 CCATTAGGAGGGGCCTCCTGGTA No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762096_929762101 20 Left 929762096 2:44815117-44815139 CCATTAGGAGGGGCCTCCTGGTA No data
Right 929762101 2:44815160-44815182 AGACTTCTGAACCCTCAGGAAGG No data
929762096_929762102 21 Left 929762096 2:44815117-44815139 CCATTAGGAGGGGCCTCCTGGTA No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929762096 Original CRISPR TACCAGGAGGCCCCTCCTAA TGG (reversed) Intergenic