ID: 929762099

View in Genome Browser
Species Human (GRCh38)
Location 2:44815133-44815155
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929762099_929762106 22 Left 929762099 2:44815133-44815155 CCTGGTAGACACACAGGAATCAT No data
Right 929762106 2:44815178-44815200 GAAGGGCCAAAGAATGGACCAGG No data
929762099_929762102 5 Left 929762099 2:44815133-44815155 CCTGGTAGACACACAGGAATCAT No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data
929762099_929762100 0 Left 929762099 2:44815133-44815155 CCTGGTAGACACACAGGAATCAT No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762099_929762105 16 Left 929762099 2:44815133-44815155 CCTGGTAGACACACAGGAATCAT No data
Right 929762105 2:44815172-44815194 CCTCAGGAAGGGCCAAAGAATGG No data
929762099_929762101 4 Left 929762099 2:44815133-44815155 CCTGGTAGACACACAGGAATCAT No data
Right 929762101 2:44815160-44815182 AGACTTCTGAACCCTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929762099 Original CRISPR ATGATTCCTGTGTGTCTACC AGG (reversed) Intergenic