ID: 929762100

View in Genome Browser
Species Human (GRCh38)
Location 2:44815156-44815178
Sequence CGAGAGACTTCTGAACCCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929762087_929762100 30 Left 929762087 2:44815103-44815125 CCACAGCCCTTGCCCCATTAGGA No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762092_929762100 23 Left 929762092 2:44815110-44815132 CCTTGCCCCATTAGGAGGGGCCT No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762098_929762100 3 Left 929762098 2:44815130-44815152 CCTCCTGGTAGACACACAGGAAT No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762096_929762100 16 Left 929762096 2:44815117-44815139 CCATTAGGAGGGGCCTCCTGGTA No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762091_929762100 24 Left 929762091 2:44815109-44815131 CCCTTGCCCCATTAGGAGGGGCC No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762095_929762100 17 Left 929762095 2:44815116-44815138 CCCATTAGGAGGGGCCTCCTGGT No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762099_929762100 0 Left 929762099 2:44815133-44815155 CCTGGTAGACACACAGGAATCAT No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data
929762093_929762100 18 Left 929762093 2:44815115-44815137 CCCCATTAGGAGGGGCCTCCTGG No data
Right 929762100 2:44815156-44815178 CGAGAGACTTCTGAACCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929762100 Original CRISPR CGAGAGACTTCTGAACCCTC AGG Intergenic
No off target data available for this crispr