ID: 929762102

View in Genome Browser
Species Human (GRCh38)
Location 2:44815161-44815183
Sequence GACTTCTGAACCCTCAGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929762099_929762102 5 Left 929762099 2:44815133-44815155 CCTGGTAGACACACAGGAATCAT No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data
929762098_929762102 8 Left 929762098 2:44815130-44815152 CCTCCTGGTAGACACACAGGAAT No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data
929762091_929762102 29 Left 929762091 2:44815109-44815131 CCCTTGCCCCATTAGGAGGGGCC No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data
929762096_929762102 21 Left 929762096 2:44815117-44815139 CCATTAGGAGGGGCCTCCTGGTA No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data
929762093_929762102 23 Left 929762093 2:44815115-44815137 CCCCATTAGGAGGGGCCTCCTGG No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data
929762092_929762102 28 Left 929762092 2:44815110-44815132 CCTTGCCCCATTAGGAGGGGCCT No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data
929762095_929762102 22 Left 929762095 2:44815116-44815138 CCCATTAGGAGGGGCCTCCTGGT No data
Right 929762102 2:44815161-44815183 GACTTCTGAACCCTCAGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929762102 Original CRISPR GACTTCTGAACCCTCAGGAA GGG Intergenic