ID: 929763612

View in Genome Browser
Species Human (GRCh38)
Location 2:44826212-44826234
Sequence AGATTTGTCTGGAGGGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929763612_929763618 5 Left 929763612 2:44826212-44826234 CCTTCTGCCCTCCAGACAAATCT No data
Right 929763618 2:44826240-44826262 CCTCTGTGACTCGACCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929763612 Original CRISPR AGATTTGTCTGGAGGGCAGA AGG (reversed) Intergenic
No off target data available for this crispr