ID: 929763713

View in Genome Browser
Species Human (GRCh38)
Location 2:44826787-44826809
Sequence GCATTAGCATGCCAGTGCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929763710_929763713 3 Left 929763710 2:44826761-44826783 CCCTTCTGCACACAGCTGGTCTG No data
Right 929763713 2:44826787-44826809 GCATTAGCATGCCAGTGCTGAGG No data
929763707_929763713 16 Left 929763707 2:44826748-44826770 CCCTCGCTAAGCTCCCTTCTGCA No data
Right 929763713 2:44826787-44826809 GCATTAGCATGCCAGTGCTGAGG No data
929763706_929763713 23 Left 929763706 2:44826741-44826763 CCAGGGACCCTCGCTAAGCTCCC No data
Right 929763713 2:44826787-44826809 GCATTAGCATGCCAGTGCTGAGG No data
929763708_929763713 15 Left 929763708 2:44826749-44826771 CCTCGCTAAGCTCCCTTCTGCAC No data
Right 929763713 2:44826787-44826809 GCATTAGCATGCCAGTGCTGAGG No data
929763711_929763713 2 Left 929763711 2:44826762-44826784 CCTTCTGCACACAGCTGGTCTGC No data
Right 929763713 2:44826787-44826809 GCATTAGCATGCCAGTGCTGAGG No data
929763705_929763713 24 Left 929763705 2:44826740-44826762 CCCAGGGACCCTCGCTAAGCTCC No data
Right 929763713 2:44826787-44826809 GCATTAGCATGCCAGTGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929763713 Original CRISPR GCATTAGCATGCCAGTGCTG AGG Intergenic
No off target data available for this crispr