ID: 929765415

View in Genome Browser
Species Human (GRCh38)
Location 2:44839978-44840000
Sequence CTGTAAACAAAGATGTATTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929765407_929765415 17 Left 929765407 2:44839938-44839960 CCTCTCCCGCCTCCACGAATCTG No data
Right 929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG No data
929765413_929765415 5 Left 929765413 2:44839950-44839972 CCACGAATCTGGCTTTAGGTTGC No data
Right 929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG No data
929765410_929765415 11 Left 929765410 2:44839944-44839966 CCGCCTCCACGAATCTGGCTTTA No data
Right 929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG No data
929765409_929765415 12 Left 929765409 2:44839943-44839965 CCCGCCTCCACGAATCTGGCTTT No data
Right 929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG No data
929765406_929765415 30 Left 929765406 2:44839925-44839947 CCTACGTAAAGAACCTCTCCCGC No data
Right 929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG No data
929765412_929765415 8 Left 929765412 2:44839947-44839969 CCTCCACGAATCTGGCTTTAGGT No data
Right 929765415 2:44839978-44840000 CTGTAAACAAAGATGTATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929765415 Original CRISPR CTGTAAACAAAGATGTATTT GGG Intergenic
No off target data available for this crispr