ID: 929766088

View in Genome Browser
Species Human (GRCh38)
Location 2:44845043-44845065
Sequence TGGCCCCTCTCTAACACATG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929766088_929766097 -1 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766097 2:44845065-44845087 AGGAGGGCTTGGCAGCTGACGGG No data
929766088_929766100 9 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766100 2:44845075-44845097 GGCAGCTGACGGGATGTGGTGGG No data
929766088_929766102 13 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766102 2:44845079-44845101 GCTGACGGGATGTGGTGGGGAGG No data
929766088_929766101 10 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766101 2:44845076-44845098 GCAGCTGACGGGATGTGGTGGGG No data
929766088_929766096 -2 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766096 2:44845064-44845086 CAGGAGGGCTTGGCAGCTGACGG No data
929766088_929766103 14 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766103 2:44845080-44845102 CTGACGGGATGTGGTGGGGAGGG No data
929766088_929766106 23 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766106 2:44845089-44845111 TGTGGTGGGGAGGGAAAGGGAGG No data
929766088_929766105 20 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766105 2:44845086-44845108 GGATGTGGTGGGGAGGGAAAGGG No data
929766088_929766104 19 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766104 2:44845085-44845107 GGGATGTGGTGGGGAGGGAAAGG No data
929766088_929766099 8 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766099 2:44845074-44845096 TGGCAGCTGACGGGATGTGGTGG No data
929766088_929766098 5 Left 929766088 2:44845043-44845065 CCCCATGTGTTAGAGAGGGGCCA No data
Right 929766098 2:44845071-44845093 GCTTGGCAGCTGACGGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929766088 Original CRISPR TGGCCCCTCTCTAACACATG GGG (reversed) Intergenic
No off target data available for this crispr