ID: 929768327

View in Genome Browser
Species Human (GRCh38)
Location 2:44869613-44869635
Sequence ATTTAGATAGGCAGAGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929768327_929768331 -5 Left 929768327 2:44869613-44869635 CCCTCTGCTCTGCCTATCTAAAT No data
Right 929768331 2:44869631-44869653 TAAATCCTGGTTATCTTTTCAGG No data
929768327_929768333 21 Left 929768327 2:44869613-44869635 CCCTCTGCTCTGCCTATCTAAAT No data
Right 929768333 2:44869657-44869679 TGCTGAAGTCCCACTCCTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929768327 Original CRISPR ATTTAGATAGGCAGAGCAGA GGG (reversed) Intergenic
No off target data available for this crispr