ID: 929770104

View in Genome Browser
Species Human (GRCh38)
Location 2:44884645-44884667
Sequence TGAGGGAGAGGAGGGTACGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929770104_929770115 8 Left 929770104 2:44884645-44884667 CCCTCGTACCCTCCTCTCCCTCA No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data
929770104_929770113 1 Left 929770104 2:44884645-44884667 CCCTCGTACCCTCCTCTCCCTCA No data
Right 929770113 2:44884669-44884691 CCTCTCTCTGTGACTATGTATGG No data
929770104_929770114 2 Left 929770104 2:44884645-44884667 CCCTCGTACCCTCCTCTCCCTCA No data
Right 929770114 2:44884670-44884692 CTCTCTCTGTGACTATGTATGGG No data
929770104_929770116 9 Left 929770104 2:44884645-44884667 CCCTCGTACCCTCCTCTCCCTCA No data
Right 929770116 2:44884677-44884699 TGTGACTATGTATGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929770104 Original CRISPR TGAGGGAGAGGAGGGTACGA GGG (reversed) Intergenic
No off target data available for this crispr