ID: 929770109

View in Genome Browser
Species Human (GRCh38)
Location 2:44884662-44884684
Sequence TAGTCACAGAGAGAGGGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929770109_929770115 -9 Left 929770109 2:44884662-44884684 CCCTCACCCTCTCTCTGTGACTA No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data
929770109_929770116 -8 Left 929770109 2:44884662-44884684 CCCTCACCCTCTCTCTGTGACTA No data
Right 929770116 2:44884677-44884699 TGTGACTATGTATGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929770109 Original CRISPR TAGTCACAGAGAGAGGGTGA GGG (reversed) Intergenic
No off target data available for this crispr