ID: 929770110

View in Genome Browser
Species Human (GRCh38)
Location 2:44884663-44884685
Sequence ATAGTCACAGAGAGAGGGTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929770110_929770116 -9 Left 929770110 2:44884663-44884685 CCTCACCCTCTCTCTGTGACTAT No data
Right 929770116 2:44884677-44884699 TGTGACTATGTATGGGAGATGGG No data
929770110_929770115 -10 Left 929770110 2:44884663-44884685 CCTCACCCTCTCTCTGTGACTAT No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929770110 Original CRISPR ATAGTCACAGAGAGAGGGTG AGG (reversed) Intergenic
No off target data available for this crispr