ID: 929770115

View in Genome Browser
Species Human (GRCh38)
Location 2:44884676-44884698
Sequence CTGTGACTATGTATGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929770108_929770115 -4 Left 929770108 2:44884657-44884679 CCTCTCCCTCACCCTCTCTCTGT No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data
929770110_929770115 -10 Left 929770110 2:44884663-44884685 CCTCACCCTCTCTCTGTGACTAT No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data
929770102_929770115 14 Left 929770102 2:44884639-44884661 CCCTCTCCCTCGTACCCTCCTCT No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data
929770106_929770115 0 Left 929770106 2:44884653-44884675 CCCTCCTCTCCCTCACCCTCTCT No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data
929770103_929770115 13 Left 929770103 2:44884640-44884662 CCTCTCCCTCGTACCCTCCTCTC No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data
929770109_929770115 -9 Left 929770109 2:44884662-44884684 CCCTCACCCTCTCTCTGTGACTA No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data
929770104_929770115 8 Left 929770104 2:44884645-44884667 CCCTCGTACCCTCCTCTCCCTCA No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data
929770107_929770115 -1 Left 929770107 2:44884654-44884676 CCTCCTCTCCCTCACCCTCTCTC No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data
929770105_929770115 7 Left 929770105 2:44884646-44884668 CCTCGTACCCTCCTCTCCCTCAC No data
Right 929770115 2:44884676-44884698 CTGTGACTATGTATGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929770115 Original CRISPR CTGTGACTATGTATGGGAGA TGG Intergenic
No off target data available for this crispr