ID: 929770285

View in Genome Browser
Species Human (GRCh38)
Location 2:44885960-44885982
Sequence CAACTAAGGCTGCCACATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929770285_929770290 3 Left 929770285 2:44885960-44885982 CCTGCATGTGGCAGCCTTAGTTG No data
Right 929770290 2:44885986-44886008 CCTCGTTTATTATTGTAATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929770285 Original CRISPR CAACTAAGGCTGCCACATGC AGG (reversed) Intergenic
No off target data available for this crispr