ID: 929772342

View in Genome Browser
Species Human (GRCh38)
Location 2:44902920-44902942
Sequence AAAATGAAAGTACCTCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 20, 1: 68, 2: 124, 3: 135, 4: 300}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929772342_929772346 4 Left 929772342 2:44902920-44902942 CCAATCAGAGGTACTTTCATTTT 0: 20
1: 68
2: 124
3: 135
4: 300
Right 929772346 2:44902947-44902969 CTACCACACAGAAAAAGGAGGGG No data
929772342_929772345 3 Left 929772342 2:44902920-44902942 CCAATCAGAGGTACTTTCATTTT 0: 20
1: 68
2: 124
3: 135
4: 300
Right 929772345 2:44902946-44902968 ACTACCACACAGAAAAAGGAGGG No data
929772342_929772343 -1 Left 929772342 2:44902920-44902942 CCAATCAGAGGTACTTTCATTTT 0: 20
1: 68
2: 124
3: 135
4: 300
Right 929772343 2:44902942-44902964 TTCAACTACCACACAGAAAAAGG No data
929772342_929772344 2 Left 929772342 2:44902920-44902942 CCAATCAGAGGTACTTTCATTTT 0: 20
1: 68
2: 124
3: 135
4: 300
Right 929772344 2:44902945-44902967 AACTACCACACAGAAAAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929772342 Original CRISPR AAAATGAAAGTACCTCTGAT TGG (reversed) Intergenic
900468755 1:2840232-2840254 AAACGGAAAGTACCTCTGATTGG - Intergenic
900682093 1:3922514-3922536 AAATGGAAAGTAGCTCTGATTGG - Intergenic
900775591 1:4582470-4582492 AAAAGGAGAGAACATCTGATTGG + Intergenic
901735127 1:11307363-11307385 GAAATTAAATTATCTCTGATAGG + Intergenic
902032764 1:13434708-13434730 AAATGGAAAGTACCTCTGATTGG + Intergenic
902353173 1:15873922-15873944 AAAGCTAAAGTACCTTTGATTGG - Intronic
902541201 1:17156227-17156249 AAATTGAAAGTATCTCTGATTGG + Intergenic
903188816 1:21644953-21644975 ACAAGGAAACAACCTCTGATGGG - Intronic
904381612 1:30115175-30115197 AAAATGAAAGAAATTGTGATGGG - Intergenic
904950695 1:34236191-34236213 AAATTGAAGGTATCTCTGATTGG + Intergenic
905055995 1:35093985-35094007 AAAATGAAAGAACCACTTTTAGG + Exonic
905216502 1:36412075-36412097 AAATGGAAAGTACCTCTGATTGG - Intergenic
906062253 1:42956830-42956852 GAAATGAAATTAAATCTGATGGG + Intronic
907700209 1:56779008-56779030 AAAATATAAGTACTTCTGATTGG + Intronic
908179658 1:61591373-61591395 AAAAAGAAAGTACCACAGACTGG + Intergenic
909498183 1:76303283-76303305 AAATGGAAAGTATCTCTGATTGG - Intronic
909706769 1:78594697-78594719 AAATGGAAAGTACCTCTGACTGG + Intergenic
909740299 1:79020520-79020542 TACATGAAAGTACCTCAGATTGG + Intergenic
910027870 1:82680127-82680149 AAGATGAAATAACTTCTGATGGG + Intergenic
910734969 1:90443582-90443604 AAATGGAAAGTACCTCTGACTGG - Intergenic
910989720 1:93042564-93042586 AAACTGAAACTACCTCTGAGTGG - Intergenic
911131386 1:94391917-94391939 AAATTGAAAGAACCTCTGATTGG - Intergenic
911211496 1:95143123-95143145 AAACTGAAAGTACCTCTGATTGG - Intronic
911809932 1:102263097-102263119 AAAATGAAAGTACCTCTGATTGG + Intergenic
912282508 1:108331018-108331040 AAAATGAAAGGAATTCTGCTAGG + Intergenic
912434345 1:109649517-109649539 AAATGGACAGTTCCTCTGATTGG + Intergenic
912731605 1:112111840-112111862 AATGGAAAAGTACCTCTGATTGG + Intergenic
912882447 1:113429718-113429740 AAAATGAAAGTACCTCTGACTGG - Intronic
913928398 1:124923918-124923940 AAAAGGAAAGTACAACTGCTGGG - Intergenic
913991916 1:143620941-143620963 AAAATCAAAGAACCTATAATAGG - Intergenic
915744848 1:158147943-158147965 AAACTGAAAGTACCTCTGATTGG + Intergenic
916283852 1:163082663-163082685 AAAATGAAGATACATGTGATAGG + Intergenic
916337025 1:163684338-163684360 AAAATGAAAGTGACTCTAATTGG + Intergenic
916918010 1:169430986-169431008 AAATTGAAAGTACCCCTGATTGG - Intronic
918950730 1:191132877-191132899 AAAAAAAAATTACATCTGATGGG + Intergenic
919079491 1:192852666-192852688 AAACTGAAAATAACTCTGAGAGG + Intergenic
919136672 1:193517876-193517898 AAAAGTAAATTAACTCTGATAGG - Intergenic
920899243 1:210090100-210090122 AAATGGGAAGTACCTCTGATTGG - Intronic
921256633 1:213347215-213347237 AAAATGAAATTAACATTGATTGG + Intergenic
921410141 1:214826954-214826976 AACTGGAAAGTACCTCTGATTGG - Intergenic
922371876 1:224919564-224919586 AAAATGAAAGTACATTTCACAGG + Intronic
922371907 1:224919768-224919790 AAATTGAAAGTACCTCTGATTGG - Intronic
923867553 1:237956197-237956219 TATATAAAAGAACCTCTGATAGG + Intergenic
924251016 1:242133080-242133102 AAATGGAAAGTACCTCTGACTGG + Intronic
924789179 1:247228269-247228291 AAAATGAAAGTACCTCTGATTGG + Intergenic
1063056073 10:2505856-2505878 AAAATGAAAGGCCCACTGTTGGG - Intergenic
1063080216 10:2760803-2760825 AAATTGAAAGTAACTCTGATTGG + Intergenic
1064351968 10:14584811-14584833 AAACTGAAAGGACCTCTGCTTGG + Intronic
1064377759 10:14812322-14812344 AAATTGAAAGTACCTCTGATTGG + Intergenic
1064408417 10:15084828-15084850 AAATTGAAAGTATCTCTGACTGG - Intronic
1064426537 10:15234639-15234661 AAAAGAAAAGTACATCTGATCGG - Intronic
1064426589 10:15234960-15234982 AAATGAAAAGTACCTCTGATCGG - Intronic
1064457177 10:15498677-15498699 AAAATGTAAATACCCTTGATCGG + Intergenic
1064594435 10:16928890-16928912 AAAATCAGAGTACCTGGGATTGG + Intronic
1065444918 10:25788360-25788382 AAAATGTAAGTTCCTCTGGAAGG - Intergenic
1065664814 10:28047168-28047190 AAAATGAGATTACATCTCATCGG - Intergenic
1065701482 10:28430154-28430176 AAATTGAAAGTACCTCTGATTGG - Intergenic
1065841193 10:29702818-29702840 TAAATGAAGGTATCTATGATGGG - Intronic
1066259986 10:33720059-33720081 AAATTGAAAGTACTTCTGATTGG + Intergenic
1066270308 10:33816053-33816075 AAATTGAAAGTACCTCTGATTGG - Intergenic
1066302038 10:34105807-34105829 AAAGTGAAATTCCCTGTGATGGG + Intergenic
1066596468 10:37055967-37055989 ATAATGAGAGTACCTATGTTAGG + Intergenic
1067312490 10:45127152-45127174 AAAATGATATCACCCCTGATGGG + Intergenic
1067530049 10:47063870-47063892 AAATTGAAGGTACCTCTGGTTGG + Intergenic
1067550131 10:47228506-47228528 TAATTGAAAGTACCTCTGATTGG + Intergenic
1067826011 10:49573463-49573485 AAATTGAAAGTAAGTCTGATCGG - Intergenic
1067977475 10:51042450-51042472 GAAATGAAAGTAGCTCAGTTTGG - Intronic
1068620806 10:59179563-59179585 AAATTAAAAATATCTCTGATTGG - Intronic
1068816860 10:61325864-61325886 AAAATTAAAGTAACTATGTTGGG + Intergenic
1069818948 10:71215970-71215992 AAAGTGAAAGTACCACTGCAGGG + Intronic
1070985843 10:80689041-80689063 AAAATTAAAGTAATTCTGCTGGG + Intergenic
1071870173 10:89785404-89785426 AAATTGAAAGTACCTCTGATTGG - Intergenic
1071965925 10:90852667-90852689 AAAATGAATGAACCACTGATAGG + Intronic
1072460115 10:95611002-95611024 TAAATGATAGTGCCTCTGACAGG + Intronic
1073876997 10:107936405-107936427 AAAATGAAAGTACCTGTGATTGG + Intergenic
1074272807 10:111971705-111971727 ACAAGGAAAGTGCCTCTGAGGGG - Intergenic
1074695776 10:116049232-116049254 AAATTGAAAGTACCTCTGATTGG + Intergenic
1075155518 10:119973483-119973505 GAAATGAAAGTATCTCTGATTGG - Intergenic
1078499600 11:11857748-11857770 AAATTGAAAGTACCTCTGGTTGG + Intronic
1080307990 11:30857375-30857397 AAAATGACAGAATCTCTGAAAGG + Intronic
1080374407 11:31691046-31691068 AAAGTGAAGGTACCTGTGACTGG - Intronic
1080531335 11:33179591-33179613 AAATTGAAAGTACCTGTGATTGG - Intergenic
1080899892 11:36479879-36479901 AAAACGAGATTACCTCAGATTGG + Intergenic
1081013145 11:37841381-37841403 AAATTAAAAGTACTTCTGATTGG + Intergenic
1081225286 11:40513777-40513799 GAAATGAAAGTACTTCTGTAAGG - Intronic
1081524861 11:43920475-43920497 AAGATGAAACCACCTCTGTTTGG - Intergenic
1081711360 11:45218514-45218536 AAAATCAAAGTCTGTCTGATTGG - Intronic
1081722816 11:45302618-45302640 AAACTGAAAGGACCTCTAATTGG - Intergenic
1082937619 11:58670697-58670719 AAATTGAAAGTACCTCTGACTGG - Intronic
1082961623 11:58923471-58923493 AAAGGGAAAGTACCTCTGTTTGG - Intronic
1084765557 11:71305944-71305966 AAAATGAAAGTGCCACTGGAAGG + Intergenic
1084895980 11:72269397-72269419 AACATGACAGAAGCTCTGATAGG + Intergenic
1085333780 11:75674155-75674177 AAAATGAAAGTACCTCTGATTGG + Intergenic
1085483742 11:76844010-76844032 AAATTTAAAGTATCTCTAATTGG + Intergenic
1085874745 11:80392688-80392710 AAAATGAAATTACATATGGTAGG + Intergenic
1086165827 11:83776580-83776602 ACAATGAAAGGACCTTTGAAAGG - Intronic
1086849659 11:91794377-91794399 AAATGGGAGGTACCTCTGATTGG - Intergenic
1087137323 11:94734144-94734166 GAAATGAAATTAACTCTGACAGG - Intronic
1087591283 11:100191436-100191458 AAAATGAAGGAACCTCTTATTGG + Intronic
1087711768 11:101562098-101562120 AAATTCAAACTACCTTTGATTGG + Intronic
1087995194 11:104797643-104797665 AAATGGAAAGTATCTCTGATTGG - Intergenic
1088295281 11:108286581-108286603 AAATTGAAAGTACCTCTGATTGG - Intronic
1089119874 11:116126142-116126164 AAAGTGAAATTTGCTCTGATGGG - Intergenic
1089593013 11:119556860-119556882 AAATGGAAAGTACCTCTGATTGG + Intergenic
1091435208 12:466916-466938 AAACTGAAAATACCTGTGTTGGG + Intronic
1092251526 12:6901011-6901033 AAAATGAAAGTACGTCTGATTGG - Intronic
1092644357 12:10553139-10553161 AAAATGAAAGTATCTTTCATTGG + Intergenic
1092655319 12:10677913-10677935 AAAATGAAAGGACCTCCAATTGG - Intergenic
1092845516 12:12581280-12581302 AAAATGAAAGCACCGCTGTTGGG - Intergenic
1094288539 12:28819977-28819999 AAATGGAAAGTTCCTCAGATTGG - Intergenic
1094605454 12:31945260-31945282 AACGTGAAGGTACTTCTGATTGG - Intergenic
1094607930 12:31965315-31965337 AAAATGAAAGTACCTCTGATTGG + Intronic
1095240453 12:39852745-39852767 AAATGGAAAGTACCTCTGATTGG + Intronic
1095390288 12:41697984-41698006 AAAATGCATGTTGCTCTGATAGG - Intergenic
1095392063 12:41719352-41719374 AAATGGAAAGTACATCTGATTGG + Intergenic
1095486661 12:42692095-42692117 AAATTGAAAGTACTTCTGATTGG + Intergenic
1095486992 12:42695529-42695551 AGATTGAAAGTACCTCTGATTGG + Intergenic
1095784183 12:46091731-46091753 AAAATAACAGTACCTATAATGGG + Intergenic
1096434744 12:51579714-51579736 AAAATGAAAGTACCTGCGATTGG - Intergenic
1096996993 12:55844573-55844595 AAAATAAAAATACCTATTATTGG + Intergenic
1097364145 12:58692446-58692468 AAAATGACAGATCATCTGATAGG + Intronic
1097424046 12:59419713-59419735 AAATAGAAAGTACCTCTGATTGG + Intergenic
1097479195 12:60099917-60099939 AAAATGAAAGTACCTCTGATTGG - Intergenic
1097932157 12:65200086-65200108 AAATGGAAAGTACCTTTGATTGG + Intronic
1098135511 12:67397639-67397661 AAATTGAACATATCTCTGATTGG - Intergenic
1098243266 12:68489095-68489117 AAAATATAAGTACCTTAGATTGG - Intergenic
1098265229 12:68711370-68711392 AAAATAAAAGTAACTCAGAAGGG + Intronic
1098543342 12:71684311-71684333 AAATTGAAAGTATCTCTGCTTGG - Intronic
1098711407 12:73767445-73767467 AAATGGAAAGTATGTCTGATTGG - Intergenic
1100572583 12:95857349-95857371 AAAATGAAAGTACCTCTTATTGG + Intergenic
1104279395 12:127360659-127360681 AAATGGAAAGTACCTCTGATTGG + Intergenic
1104301811 12:127571248-127571270 AAAATGAAACTCACACTGATTGG - Intergenic
1104652974 12:130550440-130550462 CAAATGAAAGTAATTCTGAAGGG + Intronic
1105540867 13:21315327-21315349 ATAATGAAAGTACTTCAAATTGG - Intergenic
1106598945 13:31170886-31170908 AAATTGAAAGTACCTCTGACTGG + Intergenic
1106601557 13:31191857-31191879 AAATTGAAAGTATCAATGATTGG + Intergenic
1106857448 13:33868460-33868482 AAATGGAAAGTACCTTTGATTGG + Intronic
1107407684 13:40129791-40129813 AAATTGAAAGTACCTCTGATTGG - Intergenic
1108180553 13:47835990-47836012 TGAAAGTAAGTACCTCTGATTGG + Intergenic
1108356815 13:49635829-49635851 AAACTGAAAGTACCTCTGATTGG - Intergenic
1108467450 13:50730998-50731020 AAATGGAAAGTACCCCTGATTGG + Intronic
1109631204 13:65049073-65049095 AAATTGAAGGTACCTCTGACTGG - Intergenic
1110251245 13:73383132-73383154 AAATTGAAAGTACTTCTAATTGG + Intergenic
1110555663 13:76856528-76856550 AAACTGAAAATACCTCTGATTGG - Intergenic
1110574053 13:77036142-77036164 AAATTGAAAGTACCTCTGATTGG - Intergenic
1110964671 13:81677845-81677867 AAATGGAAGGTACCTCTGATTGG + Intergenic
1111055517 13:82944421-82944443 AAATGGAAAGTACCTCTGTTTGG - Intergenic
1111180153 13:84653427-84653449 AAACTGAAAGAACCTCTTACTGG - Intergenic
1111643254 13:90997287-90997309 AAAATGAAAATATCTCTGGAAGG - Intergenic
1112404306 13:99104690-99104712 AAATTGTACGTATCTCTGATTGG - Intergenic
1112449601 13:99496894-99496916 AAATTGAAAGTGCCTCTGATTGG - Intergenic
1112638599 13:101245829-101245851 TAATTGAAAGTACCTCTGATCGG + Intronic
1113059496 13:106307063-106307085 AAATGGAAAGTACTTCTTATTGG - Intergenic
1113219327 13:108080926-108080948 AAAATTACATTACCTCTCATAGG - Intergenic
1114953225 14:27783171-27783193 AAAATAAAAGTATCTGAGATGGG + Intergenic
1115338827 14:32270666-32270688 AACATGAAAGTGCCTCTGATTGG + Intergenic
1115909399 14:38238913-38238935 AAAATGAAATTACATATCATAGG - Intergenic
1116416810 14:44687801-44687823 TAAATAAAAGTTACTCTGATAGG + Intergenic
1116949493 14:50866113-50866135 AAAATAAAATAATCTCTGATTGG + Intronic
1117516718 14:56509093-56509115 AAAATGCAAGTACCCCTGCAGGG + Intronic
1117657399 14:57970496-57970518 AAAAAAATAGTACCTCTGTTTGG - Intronic
1120535111 14:85685211-85685233 AAAATAACAGTCACTCTGATTGG - Intergenic
1120820507 14:88907601-88907623 AAATGGAAAGTACCTCTGACTGG + Intergenic
1121429351 14:93875926-93875948 AAATTGAAAATACCTCTGATTGG + Intergenic
1121435522 14:93916735-93916757 AAATGTAAAGTACCTCTGATCGG - Intergenic
1122005178 14:98697526-98697548 CAAAGGGAACTACCTCTGATGGG - Intergenic
1122045598 14:99021025-99021047 CACAAGAGAGTACCTCTGATGGG + Intergenic
1123833713 15:24167465-24167487 AAAATGATTGTACCTGTGATAGG - Intergenic
1123840450 15:24242498-24242520 AAAATGATCATACCTGTGATAGG - Intergenic
1123853400 15:24383028-24383050 AAAATGATCATACCTGTGATAGG - Intergenic
1123869365 15:24555633-24555655 AAAATGATCATACCTGTGATAGG - Intergenic
1125196752 15:37056320-37056342 AAAATGGGTGTGCCTCTGATGGG + Intronic
1125555697 15:40582866-40582888 AAATTGAAAGTACCTCTGATTGG + Intergenic
1127147901 15:56043608-56043630 AAATTTAAAATACTTCTGATTGG + Intergenic
1127404584 15:58628845-58628867 AAAATGAAAGTAACTTAGTTGGG - Intronic
1127891805 15:63258848-63258870 AAATGGAAAGTACCTCTGATTGG - Intronic
1128214612 15:65925639-65925661 GAAAGGAAAGGACCTCTGAGGGG - Intronic
1128716095 15:69909213-69909235 AAAATGAAAGTACCTCTGATTGG - Intergenic
1129063069 15:72876475-72876497 AAAACGAAAGTACCTCTGATTGG + Intergenic
1129200687 15:73997142-73997164 AAATTGAAAGTACGTCTGGTTGG - Intronic
1129386466 15:75198860-75198882 AAAGTGAAAGTGCCTCTGATTGG - Intronic
1129506613 15:76086874-76086896 AAATTGGAAGTACCTCTGATTGG - Intronic
1130213421 15:81946691-81946713 AAATTGAAAGTTCCTCTGATTGG + Intergenic
1130285964 15:82554735-82554757 AAAATGATAGTTCCTTTCATTGG - Intronic
1131070489 15:89462655-89462677 AAAATGAAAGTACCTCTGATTGG + Intergenic
1131071527 15:89469514-89469536 GAAATGAAAGTACCTCGGATTGG + Intergenic
1131325744 15:91442413-91442435 AAATTGAAAATGTCTCTGATTGG - Intergenic
1131702522 15:94954613-94954635 ATAAGGAAAGGACATCTGATAGG - Intergenic
1131758342 15:95591120-95591142 AAAATAAATGTACCTTTGATGGG - Intergenic
1131951266 15:97683932-97683954 AAATTGAAAATACCTCTGATTGG - Intergenic
1132783156 16:1639714-1639736 AAATTGAAAGTATCTCTGATTGG - Intronic
1133075191 16:3274780-3274802 AAATTGAAGGTACCTCTGACTGG - Intronic
1133099072 16:3468236-3468258 GAACTGAAAGTACCTCTGATTGG - Intronic
1133177588 16:4026958-4026980 AAATGGAAAGTACCTCTGATTGG + Intronic
1133679659 16:8109082-8109104 GAAGCGAAAGTACCTCTGCTTGG + Intergenic
1133679662 16:8109118-8109140 AAATTGAAAGTACCTCTGATTGG - Intergenic
1134606541 16:15575836-15575858 AAATTGAAAGTATATCTGATTGG - Intronic
1135408437 16:22215155-22215177 AAACTGAAGTTACCTCTGATTGG - Intronic
1135502745 16:23011425-23011447 AAAATGTAAGGACCTCTAATGGG - Intergenic
1136481980 16:30547824-30547846 AAAAAGAACGGACCTCTGAATGG + Intronic
1137348956 16:47693683-47693705 AAAATAAAAGTAACTCAGATTGG - Intronic
1137635973 16:49986752-49986774 AAATTGAAAGTACCTCCGATTGG - Intergenic
1137850969 16:51742214-51742236 AAATTGAAAGTACCTCTGACTGG + Intergenic
1137974990 16:53023636-53023658 AAATTGAAAGTACCTATGATTGG + Intergenic
1138807525 16:60108218-60108240 AAATGGAAAGTACCTCTGATTGG - Intergenic
1138851316 16:60633087-60633109 AAATGGAAAGTACCTCCAATTGG - Intergenic
1139253341 16:65517865-65517887 AAATTGAAAATAGCTCTGATGGG + Intergenic
1140259743 16:73367437-73367459 AAAATGATGGTACCTTTGACTGG + Intergenic
1140565551 16:76037148-76037170 AAATGGAAACTACCTCTGACTGG - Intergenic
1140830185 16:78743647-78743669 AAATTGAAAGTACCCCTGATTGG + Intronic
1140847389 16:78903494-78903516 AAATTGAAAGTACCTCTGAGTGG - Intronic
1143079756 17:4372721-4372743 AAAAAAAAAGTAACTCTGGTGGG - Intergenic
1143343841 17:6234800-6234822 AAAATGAAAATAGCTTTGTTAGG - Intergenic
1143437001 17:6936581-6936603 AAAATGAAAGTACCTCTGATTGG - Intronic
1143437571 17:6940494-6940516 AAAATGAAAGTACCTCTGATTGG - Intronic
1144153425 17:12473413-12473435 AAACTGAAGGTACCTCTGTCAGG + Intergenic
1144306012 17:13970195-13970217 AATATTAAAGTACCTCTGATTGG + Intergenic
1145220163 17:21082043-21082065 AAATGGAAAGTACCTCTGATTGG + Intergenic
1145225587 17:21125452-21125474 AAATTGAAGGTACCTCTGATTGG - Intronic
1145877267 17:28329006-28329028 AAAATAAAATTACATTTGATGGG - Intronic
1146276146 17:31517125-31517147 AAACTGAGAGTATCTCTGATTGG - Intronic
1146745158 17:35322093-35322115 AAAATGAAAGTACCTCTGATTGG + Intergenic
1146756007 17:35432639-35432661 AAACTGAAAATACCTCTGATTGG - Intronic
1148974196 17:51512412-51512434 AAATTGAAAGTACCTCTGACTGG + Intergenic
1149343188 17:55707721-55707743 CAAATAAAATAACCTCTGATGGG - Intergenic
1150889307 17:69128392-69128414 AAAATGAAAATATATCTGAGCGG + Intronic
1152831989 17:82503097-82503119 AAGATGAAAATCCCTCTGCTGGG - Intergenic
1152833171 17:82511553-82511575 AAATTGGAAGTCCTTCTGATTGG - Intergenic
1152995461 18:402325-402347 AAAATGAAAGTACCTCTGATTGG - Intronic
1153334956 18:3914025-3914047 AAAATAAAATTACCTATGGTGGG - Intronic
1153378249 18:4406232-4406254 AAATGGAAACTACTTCTGATTGG - Intronic
1153398881 18:4659384-4659406 CAAAAGAAAATACCTCTGAGGGG + Intergenic
1153539287 18:6136482-6136504 AAATTGAAAGTATCTCTGATTGG + Intronic
1153721734 18:7910740-7910762 AAATTGAAAGTACCTCTGACTGG - Intronic
1153800659 18:8665536-8665558 AAATTGGAAGTACCTCTAATTGG - Intergenic
1154335512 18:13461872-13461894 AAATTGAAAGTACCTCTGACTGG - Intronic
1154384018 18:13877275-13877297 AATTGGGAAGTACCTCTGATTGG + Intergenic
1155502755 18:26503720-26503742 AAAATGAAAGCATAACTGATCGG + Intronic
1155842097 18:30658856-30658878 AAAATAAAAATACCTCTGAGTGG - Intergenic
1156203444 18:34859574-34859596 TAATGGAAAGTACTTCTGATTGG - Intronic
1156238413 18:35227505-35227527 AAATTGAAAGTACCTCTGATTGG - Intergenic
1156849334 18:41708077-41708099 AAATTGAAAGTATCTCTGACTGG - Intergenic
1157223761 18:45845202-45845224 AAAATGCAAGTACCGCAGAAGGG - Intergenic
1158266341 18:55664662-55664684 AAATTGAAAGTACCTCTGTTTGG + Intronic
1158344922 18:56506563-56506585 AAATTGAGAGTACCTCTGACTGG + Intergenic
1158534715 18:58297153-58297175 TAAATGAAAGGTCCTCAGATGGG - Intronic
1158597231 18:58827083-58827105 AAATCAAAAGTACCTCTGATTGG + Intergenic
1158654884 18:59321585-59321607 AAATTCAAAGTATCTCTGATTGG + Intergenic
1158679871 18:59557541-59557563 AAATACGAAGTACCTCTGATTGG + Intronic
1158847684 18:61462035-61462057 AGATTGAGAGTACCTCTGATTGG - Intronic
1158943283 18:62425891-62425913 AAAGTGCAAGAACCTCTGGTCGG - Intergenic
1159239510 18:65723759-65723781 AAATGGAAAGTACCTCTGATTGG + Intergenic
1159465221 18:68773125-68773147 AGAATGAAAATACCTTTGTTTGG - Intronic
1159468851 18:68823007-68823029 AAATGGGAAGTACCTCTGATTGG + Intronic
1160037326 18:75314059-75314081 AAAATGAAAGTATCACAAATAGG + Intergenic
1160294103 18:77622216-77622238 AAAATGAAAGTACCTCTGATTGG - Intergenic
1160384005 18:78483347-78483369 ATTTTGAACGTACCTCTGATGGG + Intergenic
1162236436 19:9313254-9313276 AAATTGAAATTACTTCTGATTGG - Intergenic
1164457718 19:28422332-28422354 AAATTAAAAGTACCTTTGACTGG - Intergenic
1164500739 19:28817897-28817919 AAAATAAAATTACCTATAATTGG + Intergenic
1164648694 19:29876684-29876706 GAAATGAAAGTAATCCTGATTGG - Intergenic
1165122837 19:33573131-33573153 AAGACGAAAGTACCTCTGATTGG - Intergenic
1165533589 19:36424182-36424204 AAATGGAAAGTACCTCTGATTGG - Intergenic
1165832927 19:38738083-38738105 AATATTAGAGAACCTCTGATTGG - Intronic
1165997994 19:39858816-39858838 AGATGGAAAGTGCCTCTGATTGG - Intergenic
1166260143 19:41633402-41633424 AAATGGAAAGTACTTCTGATTGG - Intronic
1166952955 19:46442379-46442401 AAATCGAAGGTACCCCTGATTGG + Intergenic
1167012648 19:46819047-46819069 AAAATGAAAGTACCTCTGAGTGG - Intergenic
1167834823 19:52059862-52059884 AAATTAAAAGTACCTCTGATTGG + Intronic
1168560642 19:57379934-57379956 AAAATGACACAACCCCTGATAGG - Intronic
1168673248 19:58257538-58257560 AAATGGAAAGTGCCTCGGATTGG - Intronic
925372498 2:3356946-3356968 AAATTGAAAGTACCTCTGATTGG + Intronic
925974073 2:9128645-9128667 AAACTGAAAATACCGCTGGTGGG - Intergenic
926042629 2:9686329-9686351 AAAATGAAAATACTTCTGACTGG - Intergenic
926411996 2:12614336-12614358 CAAATGAAAGTTTCTCTGCTCGG + Intergenic
927132130 2:20069457-20069479 AAAAGAAAAGTAGCTCTGCTAGG + Intergenic
927272349 2:21225537-21225559 AAAATGAAAATCCCTCATATTGG - Intergenic
927533290 2:23831009-23831031 AAAAGGAAAGTGACTTTGATTGG - Intronic
928816156 2:35296731-35296753 AAAATAAAATTAACTTTGATGGG - Intergenic
929065290 2:37966911-37966933 AAAATGCATGTTGCTCTGATAGG - Intronic
929335992 2:40746330-40746352 AAAATGAAAGTACCTCTGATTGG + Intergenic
929772342 2:44902920-44902942 AAAATGAAAGTACCTCTGATTGG - Intergenic
930207734 2:48604927-48604949 AAAATTAAAGTATCTGTGAAAGG + Intronic
930269291 2:49237011-49237033 AAAGTTAAATTACATCTGATTGG - Intergenic
930501234 2:52220807-52220829 AAATGTAAAGTTCCTCTGATTGG - Intergenic
930541293 2:52710213-52710235 AACATGACAGGACCTGTGATGGG - Intergenic
930653068 2:53981561-53981583 AAATTGAAAGTATCTCTGACTGG - Intronic
931261973 2:60628151-60628173 AAAATGCAAATACCTCTGGGTGG + Intergenic
931342493 2:61414985-61415007 AAATTGAAATTACCTCTAATTGG - Intronic
931396817 2:61895268-61895290 CAGATAAAAGTACCTCTGTTGGG + Intronic
932692503 2:73925288-73925310 AAATTGAAAGTACCTCTGACTGG - Intergenic
933660660 2:84924858-84924880 AAATTGAAAGTATCTCTGATTGG + Intergenic
933792553 2:85894720-85894742 AAATGGAAAGTACCTCTGACTGG - Intergenic
934042478 2:88139543-88139565 TTACTGAAAGTAGCTCTGATGGG + Intergenic
934899729 2:98149598-98149620 AAATTGAAAGTACTTCTGACTGG - Intronic
935250366 2:101255192-101255214 AGAATAAAAGTACCTGTGAGTGG + Intronic
935501864 2:103851125-103851147 AAAATGAAACTACGTCTCTTTGG + Intergenic
936166319 2:110122753-110122775 CAAAAAAAAGTACCTCTAATGGG + Exonic
936801112 2:116268026-116268048 AAATGAAAAGTATCTCTGATTGG + Intergenic
936922397 2:117702278-117702300 AAAATGAAAGCAAATCTGAGTGG - Intergenic
938640286 2:133270661-133270683 AAATTGAAAGTATCTTTGATTGG + Intronic
938742159 2:134243183-134243205 AAAATAAAAATACCTCTGCTTGG + Intronic
938802934 2:134779391-134779413 AAATGGAAAGTACCTCTGATTGG - Intergenic
939977733 2:148738492-148738514 AAATTTAAAGTACTTTTGATTGG + Intronic
941184232 2:162301385-162301407 AAAATGCAAATGCCTCAGATTGG - Intronic
941990703 2:171554114-171554136 AAATTGAAAGTATCTCTGATTGG - Intronic
943212130 2:184980436-184980458 GATATCAAAGTACCTTTGATTGG + Intergenic
943719550 2:191189439-191189461 AAAGTGAAAGTAACTGTGGTTGG - Intergenic
943805311 2:192117688-192117710 CAGATGAAAGGACCTCTGATTGG + Intronic
945063837 2:205931714-205931736 AAATTGAAGGTACCTCTGATTGG - Intergenic
945314636 2:208359301-208359323 AAATTGAAAGCATCTCTGATTGG - Intergenic
945593727 2:211766851-211766873 GAAAGTAAAGTACTTCTGATTGG + Intronic
946577661 2:221093895-221093917 AAAATGAAAGTATCTATGTGTGG - Intergenic
946604863 2:221392590-221392612 AAATTGAAAGTACCTCTGATTGG + Intergenic
947539941 2:230969403-230969425 AAACTGAAAGTACCTCTGATTGG + Intergenic
948023067 2:234753213-234753235 AAATTGAAAGTATATCTGATTGG - Intergenic
948075467 2:235162305-235162327 AAAATGAAAGTACCTCTAATTGG - Intergenic
948381498 2:237553222-237553244 AAATGGAAAGTACCTCGGATTGG - Intronic
1169537529 20:6561265-6561287 AAATTGAAAGTACCTCTGATTGG - Intergenic
1169685633 20:8267933-8267955 AGATGGAAAGTACCTCTGATTGG - Intronic
1170117024 20:12871571-12871593 TAAATGCAAATACCTCTGAAAGG + Intergenic
1171213715 20:23336492-23336514 AAACTGAAAATACCTCTGATTGG + Intergenic
1173990276 20:47296994-47297016 AAGATGACAGCAGCTCTGATAGG - Intronic
1175622853 20:60465345-60465367 AAAATAAAAGACCCACTGATGGG + Intergenic
1175989684 20:62781876-62781898 AAATTAAAAGTATCTCTGATTGG + Intergenic
1177897108 21:26866650-26866672 AAGTGGAAAGTACCTCTGATAGG + Intergenic
1178039799 21:28627818-28627840 AAATTGAAAGTACCACTGATTGG + Intergenic
1178552820 21:33555836-33555858 TAAATGAAGGTAATTCTGATTGG + Intronic
1178975735 21:37219818-37219840 AAACTCTAAGTACCTTTGATTGG + Intergenic
1179969965 21:44830565-44830587 AAATTGAAGGTATCTCTGCTTGG - Intergenic
1181222935 22:21373632-21373654 GAAAAGAAAGTGCCTCTGCTGGG + Intergenic
1181255806 22:21561988-21562010 GAAAAGAAAGTGCCTCTGCTGGG - Intronic
1182649742 22:31841704-31841726 AAACTGAAAGTGTCTCTGATTGG - Intronic
1183144493 22:35977147-35977169 AAAATGAGAGTCCTTCTGATAGG - Intronic
1184359399 22:44005704-44005726 AAATGGGAAGTTCCTCTGATTGG + Intronic
1184819356 22:46897514-46897536 AAACTGAAAGTACCTCTGATTGG - Intronic
1184958932 22:47914753-47914775 AAATTGAAAGTATCTCTGATTGG - Intergenic
1185107779 22:48884059-48884081 AAATGGAAAGCACCTCTGACTGG + Intergenic
949280684 3:2343293-2343315 AAATGGAAAGTACCTCTGATTGG + Intronic
950070365 3:10147347-10147369 AAAAAAAAAACACCTCTGATTGG - Intronic
951356765 3:21676858-21676880 AAATTGAAAGAACAACTGATAGG + Intronic
951859777 3:27239077-27239099 AAATGGAAAGTACCTTTGATTGG - Intronic
952662148 3:35864890-35864912 AAATTGAAAGTATTTCTGATTGG + Intergenic
952849013 3:37712545-37712567 AAACTGAAAGTACCTGGGGTTGG + Intronic
953645709 3:44752156-44752178 AAAATGAAAGTGCCTCTGATTGG + Exonic
954282023 3:49587801-49587823 AAACAGAAAGTACCCCTGATTGG - Intronic
955078445 3:55635832-55635854 AAAATTAAAAAATCTCTGATGGG - Intronic
955268392 3:57470472-57470494 AAAATTAAAAAACTTCTGATAGG + Intronic
955551735 3:60092549-60092571 GAAATAAAAGCACCTCTGAATGG - Intronic
955579524 3:60404008-60404030 AAATTGAAAGTACATCTGCTTGG + Intronic
957020302 3:75118958-75118980 AAATGGAAAGTACCTCTGAATGG + Intergenic
957422636 3:79991417-79991439 AAATTGAAATTCTCTCTGATGGG - Intergenic
957729012 3:84107673-84107695 AATATGAAACTACCTTTGAATGG + Intergenic
957952871 3:87147610-87147632 AAATTGAAAGTACCTCTGAGTGG + Intergenic
957952883 3:87147720-87147742 AAATTAAAAGTATCTCTGATTGG + Intergenic
958052949 3:88371414-88371436 AAAATAAAAATACCTTAGATGGG + Intergenic
958652133 3:96950240-96950262 AGAATGAGAGAACCTCTAATAGG - Intronic
958845295 3:99258770-99258792 GAAATGAAAGTACCTCTGATTGG - Intergenic
959596700 3:108136741-108136763 AAACTGAAAGTCCCTCTGATTGG - Intergenic
959906683 3:111718118-111718140 AAAATGGAAGTACCCCTGGGAGG + Intronic
960462852 3:117958331-117958353 TAAATGAGAGTGCCTCTGAAGGG - Intergenic
960935011 3:122893831-122893853 AAAACGAAAGTATCCCTTATAGG - Intergenic
961791527 3:129380009-129380031 AATAAAAAAGTACCTCTGATTGG + Intergenic
962219035 3:133547838-133547860 AAAATGCAAATACCTCAGAGAGG + Intergenic
962291906 3:134144738-134144760 AAAATGAAGGTAACTCTGGCAGG + Intronic
962607782 3:137046598-137046620 AAAATGGTAGTACCTCTGACAGG - Intergenic
962926531 3:139998923-139998945 AAAATGAGATTACCTCTGATGGG + Intronic
963789449 3:149568580-149568602 AAAATGAAATAAGCTCTGAAGGG - Intronic
963914092 3:150841591-150841613 AAGTTGAAAGTACCTCTTATTGG + Intergenic
963996753 3:151718367-151718389 AAAATGAAATTACATCTAGTAGG - Intergenic
964128142 3:153258245-153258267 AAAGTGAAAATACCTCTGGGTGG - Intergenic
964613997 3:158643054-158643076 AAATGGAAAGTACCTCTGACTGG - Intergenic
964627806 3:158776231-158776253 AAACTGAAAGTATCTCTGATTGG - Intronic
964749615 3:160042287-160042309 AAATTGAAAGTACCTCTGATTGG - Intergenic
965258655 3:166450293-166450315 AAAATGAAACAACCTCAGAAGGG + Intergenic
965492922 3:169361998-169362020 GAAATCAAAGCACCTTTGATAGG - Intronic
965849787 3:173010036-173010058 AAAATGAAAGTACCTCTGATTGG - Intronic
966064632 3:175804029-175804051 AAAATGAAAGCATCTCACATTGG + Exonic
967135127 3:186506736-186506758 AATATGAAGGTACCACTCATGGG - Intergenic
967268532 3:187713731-187713753 AAAATGAAAGTACCTCTGATTGG - Intronic
968937620 4:3620673-3620695 AAATTGAAACTACCTCTGATTGG - Intergenic
969655566 4:8495829-8495851 AACATGAAAGTACCTCTGATTGG + Intergenic
970175259 4:13332944-13332966 AAATTGAAAGTCCCTCTGATTGG + Intergenic
970228456 4:13883987-13884009 AAATTGAAAGTACCTCTGATCGG - Intergenic
970942096 4:21646534-21646556 AAAAAAAAAGAACATCTGATTGG - Intronic
971084756 4:23260037-23260059 AAAATGAAAATACAACTTATTGG + Intergenic
971911890 4:32804702-32804724 AGAATGAAAGGACCTCTTTTGGG + Intergenic
972746087 4:41934191-41934213 AAATTGAAAGTACCTCTGATTGG + Intergenic
972769082 4:42179575-42179597 AAATTGAAAGTACCTCTGATTGG - Intergenic
972926645 4:44016670-44016692 AAAATGAAAGTACCTCCAACCGG - Intergenic
975442937 4:74433795-74433817 AAAACGAAAGTACCTCTGATTGG - Intergenic
975443876 4:74440586-74440608 AAAATGAAAGTACCTCTGATTGG - Intergenic
976620131 4:87119011-87119033 AAAATGAAAGTAACTCTGATTGG - Intronic
976814682 4:89133883-89133905 AAACTGAAAGTACCTCTGATTGG - Intergenic
977745696 4:100544171-100544193 AAAATTAAAGTATATATGATAGG - Intronic
977753808 4:100641379-100641401 AAAAGCAAAGTAGTTCTGATGGG + Intronic
977970834 4:103211995-103212017 AAAATGAAAGTATCTCAAACTGG + Intergenic
978033825 4:103971039-103971061 AAAATGAAAGTACCTTTTATTGG + Intergenic
978034788 4:103978801-103978823 AAAAAGAAAGTACCTCTAATTGG + Intergenic
978093068 4:104741557-104741579 TAAAAGAAGGAACCTCTGATAGG - Intergenic
978396412 4:108285270-108285292 AAATTAAAAGTACCTTTGATTGG - Intergenic
980113281 4:128654971-128654993 AAATTGAAAGTACCTCTGATTGG - Intergenic
980267839 4:130543060-130543082 AAAATGAAAGTACATCCCACAGG + Intergenic
980267873 4:130543210-130543232 AAGTTGAAAGTACTCCTGATTGG - Intergenic
981106652 4:140889320-140889342 AAAATCACAGTACTTCTGAAAGG - Intronic
981183554 4:141774423-141774445 AAAATTCAACTACCTCTTATAGG - Intergenic
981679408 4:147378698-147378720 AAAATGAAATTACCCAAGATGGG + Intergenic
982043400 4:151417508-151417530 AATCTGAAAGTACCTCGGATTGG - Intronic
982959163 4:161814066-161814088 AAAATGAAAGTAAGTGTGAGAGG + Intronic
983090083 4:163493154-163493176 AAAATGAAAGTGCCTCAGATTGG + Intergenic
983362978 4:166750008-166750030 AAAATGCACGTACATTTGATCGG + Intronic
983564117 4:169131716-169131738 AAACTGAAAGTACCTCTGACTGG + Intronic
983922536 4:173361591-173361613 AAAATGAAAGCACCTCAGTGAGG + Intergenic
984127571 4:175831298-175831320 AAATTGAAAGTACCTTTGAATGG + Intronic
985353146 4:189088352-189088374 AAAATCAAAGCAACTCTAATGGG - Intergenic
985721327 5:1490812-1490834 AAAATGAAACTATCCCTGAGTGG + Intronic
986238250 5:5932830-5932852 AAACTAAAAGTACCTCTGATCGG + Intergenic
986254284 5:6088812-6088834 ACACTGAAACTACCTCTGATTGG + Intergenic
986808968 5:11335793-11335815 AAATTGAAAATACCTCTGATTGG + Intronic
987137614 5:14914321-14914343 AAATTGAAAGTATCTCTGATTGG + Intergenic
987267150 5:16267671-16267693 TAAATTAAAGGACTTCTGATTGG + Intergenic
989002466 5:36775407-36775429 AAAATGAAGATACCTCTGATTGG + Intergenic
989134960 5:38144630-38144652 AGACTGAAAGTACCTACGATTGG + Intergenic
989610703 5:43287811-43287833 AATATGATAGTACCTCTCTTTGG - Intergenic
990364355 5:55054772-55054794 AAATTGAAAGTACCTCTGATTGG - Intergenic
990732699 5:58826845-58826867 AAAAGCAAAGTCCCTCTCATTGG + Intronic
990824706 5:59885697-59885719 AGAGTGAAAATAACTCTGATGGG - Intronic
991130249 5:63114507-63114529 AAAGAGAAAGTAACTCTGAAAGG - Intergenic
991186643 5:63816068-63816090 AAAATGAAGGTACCTGCAATAGG - Intergenic
991686222 5:69184832-69184854 AAGTGGAAAGTACTTCTGATTGG + Intergenic
992068572 5:73129397-73129419 AAATTGAAAGTGCCTCTAATTGG - Intronic
992171130 5:74103221-74103243 AAATGGCAAGTACCTCTGATTGG + Intergenic
994215715 5:97134935-97134957 CAAAGGAAAGTCCCTCTGCTGGG - Intronic
994352038 5:98757302-98757324 AAAATGAAGGTATCTAGGATTGG + Intergenic
994382680 5:99089927-99089949 AATATGTAAATACCTCTTATTGG - Intergenic
994581772 5:101651502-101651524 AAAATGTTAGTAGTTCTGATAGG - Intergenic
995506141 5:112862333-112862355 AAAATCAAAGTACCTCGGAGTGG - Intronic
996109590 5:119549598-119549620 AAATTGAAAATATCTGTGATTGG + Intronic
996207249 5:120756200-120756222 AAATGGAAAGTACCTCTGATTGG - Intergenic
996243626 5:121232732-121232754 AAATGGAAAGTATCTCTGACTGG - Intergenic
997033589 5:130160395-130160417 AAAATGAATGGGCCTTTGATAGG - Intronic
997830721 5:137147395-137147417 ATAATGAAAGTACCACAGACTGG + Intronic
998472853 5:142396841-142396863 AAATGGAAAGCACCTCTGATTGG - Intergenic
999362568 5:150998305-150998327 AAAAAGAAAATACCTCTGATTGG - Intergenic
999398397 5:151245668-151245690 AAATTAAAAGTGCCTCTGATTGG - Intronic
999526707 5:152414263-152414285 AAACTGAAACTACCTCTGATTGG + Intronic
999853154 5:155564743-155564765 AAAATGAAAGTACCTCTGATTGG + Intergenic
999892547 5:155994523-155994545 AAAGTGAAAGTTACTCTGAGTGG + Intronic
1000086381 5:157891074-157891096 AAATTGAAAGTACCTCTGACTGG - Intergenic
1000188358 5:158883139-158883161 AAAATGAATGTACCTCTCTCTGG - Intronic
1001126594 5:169024964-169024986 AAAATTAAATTACTTCTCATGGG + Intronic
1002015449 5:176318190-176318212 AAATTGAAAGTACCTCTGACTGG - Intronic
1003348098 6:5289752-5289774 AAATTGAAAGTATCTCTGATTGG - Intronic
1003351142 6:5318821-5318843 GAAATGAAAGTACCTCTGATTGG - Intronic
1003412028 6:5874023-5874045 ATAATGAAAGTACTTCAAATTGG + Intergenic
1005128562 6:22476046-22476068 AAAAAGTAAAGACCTCTGATAGG - Intergenic
1005322528 6:24668857-24668879 AAATTGAAAGTACCTCTGATTGG - Intronic
1005991250 6:30903843-30903865 AAAAAGAAAATTCCTGTGATAGG - Intergenic
1006209573 6:32384172-32384194 AAAAAGAAACTGCCTCTGTTAGG - Intergenic
1006226087 6:32537606-32537628 AAACTGAAAGTGCCTCTGATTGG + Intergenic
1006427130 6:33972689-33972711 AAATGGAAAGTACCTCTGATTGG - Intergenic
1006431285 6:33998445-33998467 AAATGGAAAGTACCTCTGATTGG - Intergenic
1007066873 6:38999679-38999701 AAAATACAAGTAACTCTGAGAGG + Intronic
1007532591 6:42555962-42555984 AAACTGAAAGTACCTCTGATTGG + Intergenic
1007800742 6:44390188-44390210 AAATTTAAATTAACTCTGATAGG - Intronic
1008140406 6:47825267-47825289 AATATGCAAGTACCTTTAATTGG + Intronic
1008220357 6:48846476-48846498 AAATGGAAAGTACCTCTGATTGG - Intergenic
1008373148 6:50759586-50759608 AAACAGAAAATACATCTGATAGG + Intronic
1008959207 6:57248710-57248732 AAAATGAAACTACCTCTGACTGG - Intergenic
1009263484 6:61525393-61525415 AAAAAGAAAATACCTCCCATTGG + Intergenic
1009765749 6:68073234-68073256 TAAATGAAAGTTTCTCAGATGGG - Intergenic
1009892012 6:69696207-69696229 AAATTGAAAGAATTTCTGATTGG - Intronic
1010405923 6:75505706-75505728 AAATGGAAAGTACTTCTGCTAGG - Intergenic
1010937319 6:81877770-81877792 AAAATAAAAATAACTCTGAAAGG + Intergenic
1010967604 6:82229734-82229756 ATAATGAAAGGACTTGTGATGGG - Intronic
1011067362 6:83341844-83341866 AAATTGAAAGTACCTCTGACTGG + Intronic
1011152350 6:84288668-84288690 AAACTGAAAGAAGCTCTGATTGG - Intergenic
1011606408 6:89110540-89110562 AAATGGAAAGTACCTCTGACTGG - Intronic
1011908826 6:92409475-92409497 AAATTGAAAATACCTCTGTTTGG + Intergenic
1011986866 6:93458086-93458108 AAAATTAAAGTCCCTCTTAGTGG - Intergenic
1012605291 6:101151067-101151089 GAAATTAAAGTACTTCTTATAGG + Intergenic
1012711591 6:102613736-102613758 AAATTGAAAGTACCTCTAATTGG + Intergenic
1012711946 6:102617760-102617782 AAATGGAAAGTACCTCTGATTGG + Intergenic
1012712907 6:102631450-102631472 AAAATGAAAGTACCTCTGATTGG + Intergenic
1012851224 6:104447956-104447978 AAATTGAAAGTACATCTGATTGG - Intergenic
1012884145 6:104825322-104825344 AAATTGAAAGTACCACTGATTGG + Intronic
1013534699 6:111053278-111053300 ATATTGAAAGTACCTCTGATTGG - Intergenic
1013569358 6:111405993-111406015 AAAATGGCAATACCTCTGAGTGG - Intronic
1013821561 6:114159247-114159269 AATATGAAAGCACCTCTGTTGGG - Intronic
1014199388 6:118591372-118591394 AAACTGAACGTACCTCTGATTGG + Intronic
1015014728 6:128398281-128398303 AAATTGAAAGTACCTCTGATTGG - Intronic
1015105690 6:129533415-129533437 AAAATTAAAGTACCTCTGATTGG + Intergenic
1015518416 6:134107819-134107841 AAACTGAAAATACCTCTGACTGG + Intergenic
1015547801 6:134379275-134379297 AAATGGAAAGTACCTCTGATCGG - Intergenic
1015630452 6:135227199-135227221 ATATTGAAAGTACCTCTGATTGG + Intergenic
1015855832 6:137623399-137623421 AAATTGAAAGTACCTCTGATTGG + Intergenic
1016309275 6:142715767-142715789 AAAATGTAGGTGCCTATGATTGG + Intergenic
1017006281 6:150029836-150029858 AAGCAGAAATTACCTCTGATTGG + Intergenic
1017032989 6:150240645-150240667 AAATGGAAAGTACTTCTGATAGG - Intronic
1017533013 6:155315280-155315302 AAAATTAAAGTTTCTCTGATAGG + Intergenic
1019030777 6:169009000-169009022 AAATGGAAAGTGCCTCTGATTGG - Intergenic
1019272018 7:155426-155448 AAAATGAAACTACTTTTTATTGG - Intergenic
1019521001 7:1460454-1460476 ATAAGGAAAGTCCCTCTGCTGGG + Intergenic
1019898689 7:4002832-4002854 AAATTGAAAGAGCCTCTGCTGGG + Intronic
1020567878 7:9820879-9820901 TAAATGAAAGCATTTCTGATGGG - Intergenic
1020909012 7:14104782-14104804 AAATGGAAAGTACCTCTGATTGG - Intergenic
1020932830 7:14420979-14421001 AAATGGAAAGTACCTCTGATTGG + Intronic
1021173897 7:17427950-17427972 AAATGGAAAGTACCTCTGACTGG + Intergenic
1021226847 7:18037754-18037776 AAAATGAAAGTACCACTGATTGG + Intergenic
1021236907 7:18153539-18153561 GAATTGAAAGTACCTCTAATTGG - Intronic
1021293469 7:18874592-18874614 AAAATGTAAGTACCTCTTTCAGG + Exonic
1021500515 7:21328326-21328348 AAATTGAAAGTACATCTGATTGG - Intergenic
1021604765 7:22398782-22398804 AAAATGAAAATACCTGTGGCTGG + Intergenic
1022007495 7:26279546-26279568 AAACTGAAAGTACCTCTGATTGG + Intergenic
1022160742 7:27708546-27708568 AAATGGAAGGCACCTCTGATTGG + Intergenic
1022457603 7:30572697-30572719 AAATGGAAAGTACCTCAGATTGG - Intergenic
1022458389 7:30579551-30579573 AAATGGAAAGTACCTCTGATTGG - Intergenic
1022766574 7:33418958-33418980 AAAATAAAAGTAACACTGAAAGG - Intronic
1023480385 7:40627644-40627666 AAACTGAAACTACCTCTGATTGG - Intronic
1023498419 7:40822742-40822764 AATATGAGATTACCTCAGATAGG - Intronic
1023817329 7:43961242-43961264 AAATTGAAAGTACCTCTGATTGG - Intergenic
1024423676 7:49200559-49200581 AAAATGACAGTTCCTCAGAGAGG + Intergenic
1024630335 7:51242019-51242041 AAACTGAAAGCACCTCTGACTGG + Intronic
1024752400 7:52483020-52483042 AAGCAGAAAGTACCTCTGATTGG - Intergenic
1024752402 7:52483050-52483072 AAATTGAACGTACCTCTGATTGG - Intergenic
1024829013 7:53426191-53426213 AAATTCAAAGTATCTCTGACTGG + Intergenic
1025319726 7:58083150-58083172 AAAATTAAAATACCTATAATTGG - Intergenic
1025753448 7:64312741-64312763 AAAAGGCAGGTACCTGTGATGGG - Intronic
1026184751 7:68073976-68073998 ACATTGAAAGTATCTCTGATTGG - Intergenic
1026508730 7:71009634-71009656 AAATAAAAAATACCTCTGATTGG - Intergenic
1026597674 7:71747989-71748011 AAAATGGTATTACCTCTCATTGG - Intergenic
1027005118 7:74686155-74686177 AAATTCAAAGTATCTCTGATTGG - Intronic
1027540913 7:79464136-79464158 AAAATGCAAATATCTCTGAATGG + Intergenic
1027749497 7:82124347-82124369 AAATGGAAAGTACCTCTGATTGG + Intronic
1028282692 7:88951272-88951294 AAAATTAAAGAAAATCTGATAGG + Intronic
1030714516 7:112791853-112791875 AAATTGAAAGTACCTCGGATTGG + Intergenic
1030973405 7:116090145-116090167 AAATTGAAAGTACTTCTGATTGG + Intronic
1031298313 7:120033294-120033316 AAACTGAAAGTACCTCTGATTGG + Intergenic
1032252687 7:130271615-130271637 AAATTGAAAGTACCTCTGATTGG - Intronic
1032538505 7:132684390-132684412 AAAATCAAAGTGCCTGTGAAGGG + Intronic
1032700996 7:134379018-134379040 AAATTGAAAGTACCTCTAATTGG - Intergenic
1032870663 7:135981049-135981071 AAATTGTAAGTACCTCTGACTGG - Intergenic
1033980900 7:147164413-147164435 AAAATAAAAGCACATCTGAATGG - Intronic
1033983713 7:147197089-147197111 AAATTGAAAGTATCTCTGATTGG + Intronic
1034569143 7:151941246-151941268 AAATTGCAAGTACTTCTGATTGG - Intergenic
1034742038 7:153484208-153484230 AAAATGATAGTACCTGTATTAGG + Intergenic
1035087804 7:156276128-156276150 AAATTGAAAGTACCTTTGATTGG + Intergenic
1035923497 8:3703694-3703716 AAGATGAAAGTGCCTGTGTTTGG - Intronic
1036603441 8:10284795-10284817 ATAATGAAAATAGCTCTTATTGG + Intronic
1036732786 8:11281010-11281032 AAATGGAAAGTACCTCTGATTGG - Intergenic
1037137180 8:15477026-15477048 AAATCGTAAGTACCTCTGATGGG - Intronic
1037460871 8:19107930-19107952 AAAATGAAAGTAATTCTGGTAGG + Intergenic
1037532509 8:19791352-19791374 AATTTCAAAGTATCTCTGATTGG + Intergenic
1037652921 8:20856102-20856124 AAATGGAAAGTAACTCTGATCGG - Intergenic
1037682732 8:21110920-21110942 AAATTCAAAGTACCTCTAATTGG + Intergenic
1038142687 8:24863889-24863911 AAATTGAAAGTACCTCTGATTGG - Intergenic
1038790100 8:30660788-30660810 AAATTGAAAGTACCTCTGGCCGG + Intergenic
1038947179 8:32374217-32374239 AAAATGACAGCACCTCTAATAGG - Intronic
1039297112 8:36168745-36168767 AAATTGAAAGTATCTCTGATTGG + Intergenic
1039643909 8:39258158-39258180 AAAATAAAAACACCTCTGAGCGG - Intronic
1040854532 8:51934728-51934750 AAAAGAAAAGTATCTCTTATAGG - Intergenic
1040898521 8:52392914-52392936 AAATAGAAAGTACCTCTGATTGG - Intronic
1042272058 8:66964374-66964396 AAAATGAAAGTATCCCTAAAAGG + Intronic
1042968017 8:74376643-74376665 ATAATGAAAGTCCCTCTGGCTGG - Intronic
1043178603 8:77054098-77054120 AAAATGAAAATGTCTCTGATTGG + Intergenic
1043287019 8:78545130-78545152 AAAATGAAAATACCTATAATAGG + Intronic
1043593393 8:81855930-81855952 ACATGGAATGTACCTCTGATTGG - Intergenic
1043624139 8:82233395-82233417 AAACTGAAAGTATCTGAGATAGG - Intergenic
1043820648 8:84859239-84859261 AAATTGAAAGTACCTCTGATTGG - Intronic
1043949349 8:86290782-86290804 AAATTGAAAGTACCTCTGATTGG + Intronic
1044384695 8:91573586-91573608 AAAATGAAAGTACCCTTCTTGGG - Intergenic
1044664964 8:94625241-94625263 AAAACAAAATTACCTCTGCTGGG - Intergenic
1044855526 8:96471321-96471343 AAATAGAAAGTACCTCTAATTGG + Intergenic
1044923236 8:97187619-97187641 AAAATCAAAGCCCCACTGATAGG + Intergenic
1045429091 8:102096544-102096566 AAATTGAAAGTACCTCTGATTGG + Intronic
1045793541 8:106015279-106015301 GAAATGAAATTACCTAAGATTGG + Intergenic
1045975759 8:108129006-108129028 TAAAAAAAATTACCTCTGATTGG + Intergenic
1046303175 8:112325084-112325106 AAAATTCAAGTACCACTGATAGG + Intronic
1046382527 8:113470464-113470486 AAATTGAAAGTACCTCTGATTGG - Intergenic
1046383653 8:113481265-113481287 AAATTGAAAACCCCTCTGATTGG - Intergenic
1046722536 8:117636874-117636896 AAAAAGAAAGATCCTTTGATAGG - Intergenic
1046778197 8:118186263-118186285 AAAATGAAAATATCTCTGGAAGG - Intergenic
1047390777 8:124449239-124449261 AAATTGAAAGTACCTCTGATTGG - Intergenic
1047452978 8:124983330-124983352 TAAATGAAAGTTGCTGTGATAGG + Intergenic
1047539444 8:125750268-125750290 AAAATGAAAATACCTCTGATTGG + Intergenic
1047682840 8:127272622-127272644 AAACTAAAAGTACCTCTGATTGG + Intergenic
1047743381 8:127825518-127825540 AAAATGAGAGTAGCTTTGAAGGG + Intergenic
1048748113 8:137638046-137638068 ACAATGCACATACCTCTGATAGG + Intergenic
1049248103 8:141573457-141573479 AAAATGAAAGTACCTCTGATTGG + Intergenic
1050050322 9:1593338-1593360 AAAATGAAAGACATTCTGATTGG + Intergenic
1050528581 9:6567303-6567325 AAAATGAAAAAACCTCAAATAGG - Intronic
1051645796 9:19266971-19266993 AAACTGAAAGTACGTCAAATAGG - Intronic
1051744655 9:20283894-20283916 AAAAGGAAAATGCCTCAGATGGG - Intergenic
1052488491 9:29132367-29132389 AAATGGAAAGTGCCTCTGATTGG + Intergenic
1052545084 9:29866155-29866177 AAATGGAAAGTATCTCTGATTGG - Intergenic
1052776455 9:32737980-32738002 CAAATGAAAGTATCTCTGGATGG + Intergenic
1054453539 9:65417019-65417041 AAATTGAAACTACCTCTGATTGG + Intergenic
1055803581 9:80067871-80067893 AAAGTGACAGTACCCTTGATGGG - Intergenic
1056447196 9:86677437-86677459 AAATGGAAAGTATCTCTAATTGG + Intergenic
1056452126 9:86726510-86726532 AAAAAGAAACTACTCCTGATTGG - Intergenic
1056682137 9:88728962-88728984 AAAATCAAAGAAGCTATGATAGG + Intergenic
1057244837 9:93446134-93446156 AGAATGAAAGTGCCTCTGGAAGG - Intergenic
1058374077 9:104303728-104303750 AAAGTGAAAGTAACACTGATAGG + Intergenic
1060676923 9:125523652-125523674 AAAATTACATTGCCTCTGATGGG + Intronic
1062706517 9:137947255-137947277 AAATGGAAAGTACCTCTGATTGG - Intronic
1186193939 X:7093406-7093428 AAACTGAAAGTATTTCTCATTGG + Intronic
1186818217 X:13258913-13258935 AAATGGAAAGTACCTCTAATTGG + Intergenic
1187161904 X:16773069-16773091 AAATTGAAAGCATTTCTGATTGG - Intergenic
1187335310 X:18376415-18376437 AAATGGAAAGCACCTCTGATTGG + Intergenic
1187854124 X:23620351-23620373 AAAATCAAGGTAGCACTGATTGG - Intergenic
1188120019 X:26293115-26293137 AAAATAAAAGTAACTTGGATTGG + Intergenic
1188278232 X:28228288-28228310 AAAATGAAAGGTTCTCTTATGGG + Intergenic
1189069534 X:37848966-37848988 AAATTTAAAGTACCTCTGATTGG - Intronic
1189290884 X:39885338-39885360 AAGTTGAAAGTATCTCTGATTGG - Intergenic
1189433383 X:40969490-40969512 AAATTGAAAGTACCTCTAATTGG - Intergenic
1189440751 X:41033650-41033672 AAATTGAAAGTACCTCTGATTGG - Intergenic
1189565137 X:42233964-42233986 AAAATGAAAGAAGCCCTAATCGG + Intergenic
1190408448 X:50111066-50111088 AAAATGAAAGTACATTCCATAGG + Intergenic
1190408885 X:50114890-50114912 AAATTGAAAATATCTCTGATTGG + Intergenic
1190766441 X:53479595-53479617 GAAAGGAAAGTACCTTTGATTGG - Intergenic
1190865529 X:54381524-54381546 AAATTGAAAGTACCTCTGATTGG - Intergenic
1192566583 X:72169270-72169292 AAATTGAAAGTATCTCTAATTGG - Intergenic
1193117350 X:77788281-77788303 AAACTGAAAGTATCTCTGATTGG - Intergenic
1193148529 X:78102211-78102233 AAATTGAAAGTACCTCTGATTGG + Intronic
1194491202 X:94551942-94551964 AAAATGAAAGTACCTTTGATAGG + Intergenic
1196307152 X:114117212-114117234 AAAATGAAAGGATTACTGATTGG + Intergenic
1196392113 X:115218479-115218501 AAATAGAAAGTACCTCTGATTGG + Intronic
1196774950 X:119329820-119329842 AAATTGAAAGTACCTCTGATTGG - Intergenic
1196778814 X:119363660-119363682 AAATTGAAAATACCTCTGATTGG - Intergenic
1196781690 X:119389275-119389297 TAATTGAAAGTACCTCTCATTGG + Intergenic
1196844249 X:119885937-119885959 AAATTGAAAGTACCTCTGATTGG + Intergenic
1196844253 X:119885980-119886002 AAATTGAAAGTACCTCTGATTGG + Intergenic
1196854578 X:119970806-119970828 AAATTAAAAGTATCTCTGATTGG - Intergenic
1196858095 X:120002034-120002056 AAATTAAAAGTACCTCTGATTGG - Intergenic
1196858511 X:120005996-120006018 AAGTTGAAAGTACCTGTGACTGG - Intergenic
1196872813 X:120128788-120128810 AAATTGAAAGTACCTCTGATTGG - Intergenic
1197446365 X:126555037-126555059 AAATTAAAAGTACCTCTGATTGG + Intergenic
1197717003 X:129716806-129716828 AAATTGAAAGTACCTATGATTGG - Intergenic
1197739773 X:129881021-129881043 AAATTGAAAGTACCTCTGACCGG - Intergenic
1197793342 X:130277341-130277363 ACATTGAAAGCACCTCTGATTGG + Intergenic
1197957967 X:131973469-131973491 ACAAGGAAAGTACCTTTGCTAGG + Intergenic
1198092566 X:133346140-133346162 AAATTGAAAGTACCTCTGATTGG - Intronic
1198094598 X:133366816-133366838 AAATTGAAAGTACCTCTGATTGG + Intronic
1198100920 X:133420965-133420987 AAATTGAAAGTACCTCTGATTGG + Intergenic
1198383652 X:136107082-136107104 AAATTGAATGTATCTCTGATTGG + Intergenic
1198385391 X:136124223-136124245 AAATTTAAAGTATCTCTGATTGG + Intergenic
1199357686 X:146880836-146880858 AAACTGAAAGTACTTATGGTTGG + Intergenic