ID: 929772345

View in Genome Browser
Species Human (GRCh38)
Location 2:44902946-44902968
Sequence ACTACCACACAGAAAAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929772337_929772345 29 Left 929772337 2:44902894-44902916 CCAGTTTTATTGGTTGTGGGAGG No data
Right 929772345 2:44902946-44902968 ACTACCACACAGAAAAAGGAGGG No data
929772342_929772345 3 Left 929772342 2:44902920-44902942 CCAATCAGAGGTACTTTCATTTT 0: 20
1: 68
2: 124
3: 135
4: 300
Right 929772345 2:44902946-44902968 ACTACCACACAGAAAAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929772345 Original CRISPR ACTACCACACAGAAAAAGGA GGG Intergenic
No off target data available for this crispr