ID: 929774219

View in Genome Browser
Species Human (GRCh38)
Location 2:44918145-44918167
Sequence CAGTGGGTCTGGAGGTGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929774211_929774219 -7 Left 929774211 2:44918129-44918151 CCCCTATCTCCTAAACCAGTGGG No data
Right 929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG No data
929774208_929774219 20 Left 929774208 2:44918102-44918124 CCCTGTCACGTGGAGGTTATTTT No data
Right 929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG No data
929774214_929774219 -9 Left 929774214 2:44918131-44918153 CCTATCTCCTAAACCAGTGGGTC No data
Right 929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG No data
929774213_929774219 -8 Left 929774213 2:44918130-44918152 CCCTATCTCCTAAACCAGTGGGT No data
Right 929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG No data
929774209_929774219 19 Left 929774209 2:44918103-44918125 CCTGTCACGTGGAGGTTATTTTA No data
Right 929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG No data
929774207_929774219 23 Left 929774207 2:44918099-44918121 CCACCCTGTCACGTGGAGGTTAT No data
Right 929774219 2:44918145-44918167 CAGTGGGTCTGGAGGTGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929774219 Original CRISPR CAGTGGGTCTGGAGGTGAGA TGG Intergenic
No off target data available for this crispr