ID: 929775627

View in Genome Browser
Species Human (GRCh38)
Location 2:44929229-44929251
Sequence CTATTGGACCACCTTCCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929775618_929775627 -1 Left 929775618 2:44929207-44929229 CCGCCCGCCCAGGCCGTGCGCCC No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775609_929775627 28 Left 929775609 2:44929178-44929200 CCCTTCCGAGCCCAGGCCTCGGG No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775623_929775627 -9 Left 929775623 2:44929215-44929237 CCAGGCCGTGCGCCCTATTGGAC No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775614_929775627 17 Left 929775614 2:44929189-44929211 CCAGGCCTCGGGCCTTCGCCGCC No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775612_929775627 23 Left 929775612 2:44929183-44929205 CCGAGCCCAGGCCTCGGGCCTTC No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775611_929775627 27 Left 929775611 2:44929179-44929201 CCTTCCGAGCCCAGGCCTCGGGC No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775617_929775627 5 Left 929775617 2:44929201-44929223 CCTTCGCCGCCCGCCCAGGCCGT No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775615_929775627 12 Left 929775615 2:44929194-44929216 CCTCGGGCCTTCGCCGCCCGCCC No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775622_929775627 -8 Left 929775622 2:44929214-44929236 CCCAGGCCGTGCGCCCTATTGGA No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775619_929775627 -4 Left 929775619 2:44929210-44929232 CCCGCCCAGGCCGTGCGCCCTAT No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775613_929775627 18 Left 929775613 2:44929188-44929210 CCCAGGCCTCGGGCCTTCGCCGC No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data
929775620_929775627 -5 Left 929775620 2:44929211-44929233 CCGCCCAGGCCGTGCGCCCTATT No data
Right 929775627 2:44929229-44929251 CTATTGGACCACCTTCCCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929775627 Original CRISPR CTATTGGACCACCTTCCCCC CGG Intergenic
No off target data available for this crispr