ID: 929776259

View in Genome Browser
Species Human (GRCh38)
Location 2:44932870-44932892
Sequence GATGGGAGCAATCGAGAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929776259_929776271 23 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776271 2:44932916-44932938 TGCGCCCTGGGGCTATGTCTGGG No data
929776259_929776270 22 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776270 2:44932915-44932937 GTGCGCCCTGGGGCTATGTCTGG No data
929776259_929776262 -5 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776262 2:44932888-44932910 CCATCACCCAAGCCACCTCGAGG No data
929776259_929776267 10 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776267 2:44932903-44932925 CCTCGAGGTCGAGTGCGCCCTGG No data
929776259_929776272 24 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776272 2:44932917-44932939 GCGCCCTGGGGCTATGTCTGGGG No data
929776259_929776268 11 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776268 2:44932904-44932926 CTCGAGGTCGAGTGCGCCCTGGG No data
929776259_929776274 27 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776274 2:44932920-44932942 CCCTGGGGCTATGTCTGGGGAGG No data
929776259_929776269 12 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776269 2:44932905-44932927 TCGAGGTCGAGTGCGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929776259 Original CRISPR GATGGGAGCAATCGAGAGCC AGG (reversed) Intergenic