ID: 929776260

View in Genome Browser
Species Human (GRCh38)
Location 2:44932887-44932909
Sequence CTCGAGGTGGCTTGGGTGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929776260_929776278 25 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776278 2:44932935-44932957 TGGGGAGGTCATGGCGTCTCGGG No data
929776260_929776279 26 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776279 2:44932936-44932958 GGGGAGGTCATGGCGTCTCGGGG No data
929776260_929776272 7 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776272 2:44932917-44932939 GCGCCCTGGGGCTATGTCTGGGG No data
929776260_929776267 -7 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776267 2:44932903-44932925 CCTCGAGGTCGAGTGCGCCCTGG No data
929776260_929776269 -5 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776269 2:44932905-44932927 TCGAGGTCGAGTGCGCCCTGGGG No data
929776260_929776274 10 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776274 2:44932920-44932942 CCCTGGGGCTATGTCTGGGGAGG No data
929776260_929776270 5 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776270 2:44932915-44932937 GTGCGCCCTGGGGCTATGTCTGG No data
929776260_929776276 16 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776276 2:44932926-44932948 GGCTATGTCTGGGGAGGTCATGG No data
929776260_929776277 24 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776277 2:44932934-44932956 CTGGGGAGGTCATGGCGTCTCGG No data
929776260_929776271 6 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776271 2:44932916-44932938 TGCGCCCTGGGGCTATGTCTGGG No data
929776260_929776268 -6 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776268 2:44932904-44932926 CTCGAGGTCGAGTGCGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929776260 Original CRISPR CTCGAGGTGGCTTGGGTGAT GGG (reversed) Intergenic