ID: 929776262

View in Genome Browser
Species Human (GRCh38)
Location 2:44932888-44932910
Sequence CCATCACCCAAGCCACCTCG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929776259_929776262 -5 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776262 2:44932888-44932910 CCATCACCCAAGCCACCTCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929776262 Original CRISPR CCATCACCCAAGCCACCTCG AGG Intergenic