ID: 929776262 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:44932888-44932910 |
Sequence | CCATCACCCAAGCCACCTCG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
929776259_929776262 | -5 | Left | 929776259 | 2:44932870-44932892 | CCTGGCTCTCGATTGCTCCCATC | No data | ||
Right | 929776262 | 2:44932888-44932910 | CCATCACCCAAGCCACCTCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
929776262 | Original CRISPR | CCATCACCCAAGCCACCTCG AGG | Intergenic | ||