ID: 929776267

View in Genome Browser
Species Human (GRCh38)
Location 2:44932903-44932925
Sequence CCTCGAGGTCGAGTGCGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929776259_929776267 10 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776267 2:44932903-44932925 CCTCGAGGTCGAGTGCGCCCTGG No data
929776260_929776267 -7 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776267 2:44932903-44932925 CCTCGAGGTCGAGTGCGCCCTGG No data
929776261_929776267 -8 Left 929776261 2:44932888-44932910 CCATCACCCAAGCCACCTCGAGG No data
Right 929776267 2:44932903-44932925 CCTCGAGGTCGAGTGCGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929776267 Original CRISPR CCTCGAGGTCGAGTGCGCCC TGG Intergenic