ID: 929776268

View in Genome Browser
Species Human (GRCh38)
Location 2:44932904-44932926
Sequence CTCGAGGTCGAGTGCGCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929776260_929776268 -6 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776268 2:44932904-44932926 CTCGAGGTCGAGTGCGCCCTGGG No data
929776259_929776268 11 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776268 2:44932904-44932926 CTCGAGGTCGAGTGCGCCCTGGG No data
929776261_929776268 -7 Left 929776261 2:44932888-44932910 CCATCACCCAAGCCACCTCGAGG No data
Right 929776268 2:44932904-44932926 CTCGAGGTCGAGTGCGCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929776268 Original CRISPR CTCGAGGTCGAGTGCGCCCT GGG Intergenic