ID: 929776269

View in Genome Browser
Species Human (GRCh38)
Location 2:44932905-44932927
Sequence TCGAGGTCGAGTGCGCCCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929776261_929776269 -6 Left 929776261 2:44932888-44932910 CCATCACCCAAGCCACCTCGAGG No data
Right 929776269 2:44932905-44932927 TCGAGGTCGAGTGCGCCCTGGGG No data
929776260_929776269 -5 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776269 2:44932905-44932927 TCGAGGTCGAGTGCGCCCTGGGG No data
929776259_929776269 12 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776269 2:44932905-44932927 TCGAGGTCGAGTGCGCCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929776269 Original CRISPR TCGAGGTCGAGTGCGCCCTG GGG Intergenic