ID: 929776269 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:44932905-44932927 |
| Sequence | TCGAGGTCGAGTGCGCCCTG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 929776261_929776269 | -6 | Left | 929776261 | 2:44932888-44932910 | CCATCACCCAAGCCACCTCGAGG | No data | ||
| Right | 929776269 | 2:44932905-44932927 | TCGAGGTCGAGTGCGCCCTGGGG | No data | ||||
| 929776260_929776269 | -5 | Left | 929776260 | 2:44932887-44932909 | CCCATCACCCAAGCCACCTCGAG | No data | ||
| Right | 929776269 | 2:44932905-44932927 | TCGAGGTCGAGTGCGCCCTGGGG | No data | ||||
| 929776259_929776269 | 12 | Left | 929776259 | 2:44932870-44932892 | CCTGGCTCTCGATTGCTCCCATC | No data | ||
| Right | 929776269 | 2:44932905-44932927 | TCGAGGTCGAGTGCGCCCTGGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 929776269 | Original CRISPR | TCGAGGTCGAGTGCGCCCTG GGG | Intergenic | ||