ID: 929776271

View in Genome Browser
Species Human (GRCh38)
Location 2:44932916-44932938
Sequence TGCGCCCTGGGGCTATGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929776260_929776271 6 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776271 2:44932916-44932938 TGCGCCCTGGGGCTATGTCTGGG No data
929776266_929776271 -10 Left 929776266 2:44932903-44932925 CCTCGAGGTCGAGTGCGCCCTGG No data
Right 929776271 2:44932916-44932938 TGCGCCCTGGGGCTATGTCTGGG No data
929776265_929776271 -7 Left 929776265 2:44932900-44932922 CCACCTCGAGGTCGAGTGCGCCC No data
Right 929776271 2:44932916-44932938 TGCGCCCTGGGGCTATGTCTGGG No data
929776259_929776271 23 Left 929776259 2:44932870-44932892 CCTGGCTCTCGATTGCTCCCATC No data
Right 929776271 2:44932916-44932938 TGCGCCCTGGGGCTATGTCTGGG No data
929776261_929776271 5 Left 929776261 2:44932888-44932910 CCATCACCCAAGCCACCTCGAGG No data
Right 929776271 2:44932916-44932938 TGCGCCCTGGGGCTATGTCTGGG No data
929776264_929776271 -2 Left 929776264 2:44932895-44932917 CCAAGCCACCTCGAGGTCGAGTG No data
Right 929776271 2:44932916-44932938 TGCGCCCTGGGGCTATGTCTGGG No data
929776263_929776271 -1 Left 929776263 2:44932894-44932916 CCCAAGCCACCTCGAGGTCGAGT No data
Right 929776271 2:44932916-44932938 TGCGCCCTGGGGCTATGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929776271 Original CRISPR TGCGCCCTGGGGCTATGTCT GGG Intergenic