ID: 929776276

View in Genome Browser
Species Human (GRCh38)
Location 2:44932926-44932948
Sequence GGCTATGTCTGGGGAGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929776265_929776276 3 Left 929776265 2:44932900-44932922 CCACCTCGAGGTCGAGTGCGCCC No data
Right 929776276 2:44932926-44932948 GGCTATGTCTGGGGAGGTCATGG No data
929776260_929776276 16 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776276 2:44932926-44932948 GGCTATGTCTGGGGAGGTCATGG No data
929776264_929776276 8 Left 929776264 2:44932895-44932917 CCAAGCCACCTCGAGGTCGAGTG No data
Right 929776276 2:44932926-44932948 GGCTATGTCTGGGGAGGTCATGG No data
929776266_929776276 0 Left 929776266 2:44932903-44932925 CCTCGAGGTCGAGTGCGCCCTGG No data
Right 929776276 2:44932926-44932948 GGCTATGTCTGGGGAGGTCATGG No data
929776261_929776276 15 Left 929776261 2:44932888-44932910 CCATCACCCAAGCCACCTCGAGG No data
Right 929776276 2:44932926-44932948 GGCTATGTCTGGGGAGGTCATGG No data
929776263_929776276 9 Left 929776263 2:44932894-44932916 CCCAAGCCACCTCGAGGTCGAGT No data
Right 929776276 2:44932926-44932948 GGCTATGTCTGGGGAGGTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929776276 Original CRISPR GGCTATGTCTGGGGAGGTCA TGG Intergenic