ID: 929776277

View in Genome Browser
Species Human (GRCh38)
Location 2:44932934-44932956
Sequence CTGGGGAGGTCATGGCGTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929776260_929776277 24 Left 929776260 2:44932887-44932909 CCCATCACCCAAGCCACCTCGAG No data
Right 929776277 2:44932934-44932956 CTGGGGAGGTCATGGCGTCTCGG No data
929776261_929776277 23 Left 929776261 2:44932888-44932910 CCATCACCCAAGCCACCTCGAGG No data
Right 929776277 2:44932934-44932956 CTGGGGAGGTCATGGCGTCTCGG No data
929776275_929776277 -10 Left 929776275 2:44932921-44932943 CCTGGGGCTATGTCTGGGGAGGT No data
Right 929776277 2:44932934-44932956 CTGGGGAGGTCATGGCGTCTCGG No data
929776265_929776277 11 Left 929776265 2:44932900-44932922 CCACCTCGAGGTCGAGTGCGCCC No data
Right 929776277 2:44932934-44932956 CTGGGGAGGTCATGGCGTCTCGG No data
929776273_929776277 -9 Left 929776273 2:44932920-44932942 CCCTGGGGCTATGTCTGGGGAGG No data
Right 929776277 2:44932934-44932956 CTGGGGAGGTCATGGCGTCTCGG No data
929776266_929776277 8 Left 929776266 2:44932903-44932925 CCTCGAGGTCGAGTGCGCCCTGG No data
Right 929776277 2:44932934-44932956 CTGGGGAGGTCATGGCGTCTCGG No data
929776264_929776277 16 Left 929776264 2:44932895-44932917 CCAAGCCACCTCGAGGTCGAGTG No data
Right 929776277 2:44932934-44932956 CTGGGGAGGTCATGGCGTCTCGG No data
929776263_929776277 17 Left 929776263 2:44932894-44932916 CCCAAGCCACCTCGAGGTCGAGT No data
Right 929776277 2:44932934-44932956 CTGGGGAGGTCATGGCGTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929776277 Original CRISPR CTGGGGAGGTCATGGCGTCT CGG Intergenic