ID: 929778171

View in Genome Browser
Species Human (GRCh38)
Location 2:44941379-44941401
Sequence ATCAACTTCTTTAGGAAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 361}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929778164_929778171 16 Left 929778164 2:44941340-44941362 CCATTCAACAACTCTGCCCAGGG 0: 1
1: 1
2: 0
3: 14
4: 169
Right 929778171 2:44941379-44941401 ATCAACTTCTTTAGGAAAAAGGG 0: 1
1: 0
2: 1
3: 33
4: 361
929778166_929778171 0 Left 929778166 2:44941356-44941378 CCCAGGGCTTTTCGAATTTCTGG 0: 1
1: 0
2: 0
3: 8
4: 141
Right 929778171 2:44941379-44941401 ATCAACTTCTTTAGGAAAAAGGG 0: 1
1: 0
2: 1
3: 33
4: 361
929778168_929778171 -1 Left 929778168 2:44941357-44941379 CCAGGGCTTTTCGAATTTCTGGA 0: 1
1: 0
2: 0
3: 10
4: 220
Right 929778171 2:44941379-44941401 ATCAACTTCTTTAGGAAAAAGGG 0: 1
1: 0
2: 1
3: 33
4: 361
929778162_929778171 17 Left 929778162 2:44941339-44941361 CCCATTCAACAACTCTGCCCAGG 0: 1
1: 0
2: 0
3: 13
4: 177
Right 929778171 2:44941379-44941401 ATCAACTTCTTTAGGAAAAAGGG 0: 1
1: 0
2: 1
3: 33
4: 361

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929778171 Original CRISPR ATCAACTTCTTTAGGAAAAA GGG Intergenic
901437513 1:9256767-9256789 ATCAAATTCTTTTTTAAAAACGG - Intronic
901896720 1:12319869-12319891 TTGAACTTCTTGAGGAAGAAAGG - Intronic
902267798 1:15280655-15280677 ATCAACTAACTTAGGAAAAGCGG - Intronic
902848401 1:19131417-19131439 ATTAACTTATTCATGAAAAAAGG + Intronic
903195079 1:21679999-21680021 AAAAACGTCTTTATGAAAAATGG - Intronic
903747606 1:25598696-25598718 AGCAGCTTGTTTAGGAAGAAAGG - Intergenic
906263211 1:44408158-44408180 ATCAACTCTTTTAGGGAAAACGG - Intronic
906791895 1:48666122-48666144 ATAATCATCTTTAGGCAAAATGG + Intronic
906941663 1:50261013-50261035 CTCAACTCCTTTAGCAAAATGGG - Intergenic
907920773 1:58909773-58909795 ATAAACTTGTTTATGAAACATGG + Intergenic
908968767 1:69799177-69799199 GGCAACTTCTTTATGACAAATGG - Intronic
909294174 1:73924866-73924888 AATCACTTCTTTAGAAAAAAAGG + Intergenic
909412924 1:75375439-75375461 GTCAACTTCTTTCGCAAAATTGG - Intronic
910051417 1:82978432-82978454 ATAAAATTCTTTAGTAAAACAGG + Intergenic
910823198 1:91373907-91373929 ATCAACTTCTTGAGGAAAGGGGG - Intronic
910902725 1:92139588-92139610 ATCATCTTATTTAGAAGAAAAGG + Intronic
911249696 1:95560827-95560849 TTTAACTTCTAAAGGAAAAAGGG - Intergenic
912740142 1:112186912-112186934 ATCAACGTCTATACTAAAAATGG + Intergenic
913246234 1:116872553-116872575 ATCAGTATCTCTAGGAAAAAGGG - Intergenic
913442740 1:118916147-118916169 ATAAGCTCCTTGAGGAAAAATGG - Intronic
914726471 1:150331816-150331838 CTGAACTTCTTTAGGACAGAAGG + Intronic
914800109 1:150954993-150955015 AGCGACTTCTTCAGGAAAATTGG + Intronic
917178517 1:172265986-172266008 ATCACTTTCTATAGGAAAAGGGG - Intronic
917832883 1:178912715-178912737 ATCAACTTCTGTAGCAAGATTGG + Intronic
917999494 1:180478791-180478813 ATAAACTTCTTTTTAAAAAAGGG - Intronic
918197769 1:182238343-182238365 ATCTCCTGCTTTAGGAAAAGAGG - Intergenic
918598386 1:186321011-186321033 ATTAATGTCTTTAGGAAACATGG + Intronic
919187056 1:194165117-194165139 ATAAACATATTTAGGAAAGAAGG - Intergenic
919368438 1:196695581-196695603 ATCAACTACTTTGGGCAATATGG + Intronic
920394579 1:205634873-205634895 AAACACTTCTTTAGGAAAAAGGG - Intergenic
921846017 1:219883184-219883206 TTCAACTTCCTCAGGGAAAAAGG + Intronic
923873156 1:238018455-238018477 ATCAACTCATTCATGAAAAATGG - Intergenic
1063039816 10:2325623-2325645 AGCACCTGCTGTAGGAAAAATGG + Intergenic
1063841776 10:10080633-10080655 ATCAACATCTTTAGGAAATGAGG + Intergenic
1064718123 10:18198314-18198336 ATCAACTACTATATGAAATATGG - Intronic
1065187943 10:23187563-23187585 AACAACTTCTTCAGAAAAAGGGG + Intergenic
1065402745 10:25324614-25324636 ATCACCTGCTGTTGGAAAAATGG + Intronic
1066552842 10:36578400-36578422 ATTAACTTCTTGAGGCAAAGAGG + Intergenic
1067405561 10:46020322-46020344 CTCAACTTCCTCAGGAAAAAGGG + Intronic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1068459733 10:57311742-57311764 ATCAACACCTATGGGAAAAAGGG - Intergenic
1068643849 10:59443411-59443433 ATCAACATTTTAAGGAAAACTGG + Intergenic
1068749382 10:60573955-60573977 ATTAACTTTTTCAGGAGAAATGG + Intronic
1069343935 10:67445249-67445271 AGCAACTTCATAGGGAAAAAAGG + Intronic
1071280913 10:84102344-84102366 ATAAATATCTTTAGTAAAAATGG - Intergenic
1071751097 10:88477013-88477035 ATCAACTGCTTGAAAAAAAAAGG - Intronic
1071917599 10:90312803-90312825 AAAAACTACTATAGGAAAAAAGG - Intergenic
1072129144 10:92475942-92475964 ATAATCTTCTTTAGTAAAATTGG + Exonic
1072985207 10:100133443-100133465 ATCAACTTGTTTTTCAAAAAGGG + Intergenic
1074995212 10:118751106-118751128 AGCAACTTCTGTAGAAAAATAGG - Intronic
1076341671 10:129752961-129752983 AGGAAATTCTTTAGAAAAAAGGG - Intronic
1077470596 11:2758305-2758327 ATCAACTTCGTTAGCAAAGATGG + Intronic
1077542760 11:3155246-3155268 ACCAGCTTCCTTGGGAAAAAGGG + Intronic
1078602941 11:12749420-12749442 ACAAATTTCTTTAGGGAAAAAGG - Intronic
1079164017 11:18020702-18020724 AACAACTTCTCTATTAAAAATGG + Exonic
1079572684 11:21964248-21964270 TTCAACTTCTTTGGGAGAAGTGG + Intergenic
1079783326 11:24637762-24637784 ATAAACATCTTCAGGAAACAGGG - Intronic
1081515387 11:43823800-43823822 TTCAAGTTCTTTGGGAATAAGGG + Intronic
1082188123 11:49208907-49208929 ATAATATTCTTTAGGAAAAAGGG - Intergenic
1083088200 11:60172148-60172170 ATTGACTTCTTAAGAAAAAAGGG - Intronic
1083107372 11:60371533-60371555 AGAAACTTCTATGGGAAAAAAGG + Intronic
1083132600 11:60639710-60639732 GTCAACTTCTTTTGGATAGAAGG + Intergenic
1084330753 11:68428691-68428713 ATAACCTTTTTTTGGAAAAAGGG - Intronic
1085937052 11:81159299-81159321 TTTAAATTCCTTAGGAAAAAAGG - Intergenic
1086246210 11:84756011-84756033 ATAAAATTCATTAGGAAACATGG + Intronic
1086324497 11:85684448-85684470 ATCAAGTTCTTTAACAAAGAAGG - Intergenic
1087843411 11:102943442-102943464 ATCAAATAATTTATGAAAAAGGG + Exonic
1088220815 11:107568584-107568606 ATCATCTTCCTTAGAAGAAATGG - Intergenic
1090632844 11:128665357-128665379 AGCAACTTCTCTGAGAAAAATGG + Intergenic
1091526918 12:1312000-1312022 ATCATGTTCTTGAGGAAAAATGG - Intronic
1091875608 12:3930778-3930800 AGCTTCTTCTTCAGGAAAAAGGG + Intergenic
1093065758 12:14656578-14656600 ATGAACTTCGTCAGAAAAAATGG - Exonic
1093366480 12:18305604-18305626 ATCACTTTATTTAAGAAAAATGG - Intronic
1093587439 12:20856869-20856891 CTCAAGTCCTTTAGGTAAAAAGG - Intronic
1098018142 12:66128070-66128092 TTCAACTTCTGTGAGAAAAAGGG - Intronic
1098710586 12:73754665-73754687 CTCAACATCTTTAGGAATTATGG + Intergenic
1099677554 12:85781822-85781844 ATCAACTCCTACAGGCAAAAGGG + Intergenic
1099826845 12:87786851-87786873 GTCAATATGTTTAGGAAAAATGG - Intergenic
1099850649 12:88091665-88091687 ATCAATTTTTTTAAAAAAAAGGG + Intronic
1100504918 12:95210041-95210063 AACAACTTCCTTTGAAAAAATGG - Exonic
1101201237 12:102438588-102438610 ATTAACTTCCTGAGGAACAAAGG + Intronic
1101551818 12:105770278-105770300 ATAAACGAATTTAGGAAAAAAGG + Intergenic
1102568030 12:113809800-113809822 ATGACCTTATTTGGGAAAAAAGG + Intergenic
1102777620 12:115534321-115534343 ATCTATTTCTTTAAGAAATAAGG - Intergenic
1103328687 12:120138693-120138715 ACCAGCTGCTTTAGTAAAAATGG + Exonic
1103431500 12:120891159-120891181 ATCAACCAGCTTAGGAAAAAGGG - Intronic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1105672274 13:22632636-22632658 ATAAATTACTTTAGGAAATATGG + Intergenic
1106491446 13:30227312-30227334 ATAAACTTCTTTAAGCAGAATGG + Intronic
1106534643 13:30629067-30629089 ATGAAATTCTTTAGTATAAATGG - Intronic
1106888645 13:34217984-34218006 AATAACTCCTTTAGGTAAAAAGG + Intergenic
1107040870 13:35945848-35945870 GTCAACTTATTTAGAGAAAAAGG + Intronic
1107056504 13:36110459-36110481 ATAAAATTCATTAGGAAAGAAGG - Intronic
1107385997 13:39910008-39910030 ATAAATTGCTATAGGAAAAAAGG - Intergenic
1107583936 13:41823549-41823571 AAAAACTTCTTTAGGGAAAGGGG - Intronic
1108012413 13:46031918-46031940 TTCAACTTCTTTGGGTAAATAGG - Intronic
1108270924 13:48758806-48758828 ATGACCTTCTTTGGAAAAAAGGG + Intergenic
1109101583 13:58190993-58191015 ATCAAAGCCTCTAGGAAAAAGGG - Intergenic
1109132484 13:58604803-58604825 ATCAGCTTCTGTATGTAAAAGGG - Intergenic
1109176398 13:59162357-59162379 ATCAATTTGTACAGGAAAAATGG + Intergenic
1109557258 13:63994613-63994635 ATCAACTTTATTAGTCAAAAGGG - Intergenic
1111341474 13:86891744-86891766 ATTAACAGCATTAGGAAAAAGGG + Intergenic
1111451403 13:88422984-88423006 ATCAACTTCTTTAAGAAAGGAGG - Intergenic
1112421477 13:99254113-99254135 ATTAACTTCTTTTGTAAAAATGG + Intronic
1112931527 13:104745268-104745290 CTCCACCTCTTTAGGAAAAATGG - Intergenic
1113811694 13:113146533-113146555 ATCTGCATCTTTAGGAAGAATGG + Intronic
1114336819 14:21698899-21698921 ATAAACTTCTTTTTGATAAATGG + Intergenic
1114537900 14:23434418-23434440 AACTAGTTCTTGAGGAAAAAGGG - Intronic
1115006610 14:28492966-28492988 AGCCTCTACTTTAGGAAAAAGGG + Intergenic
1115425663 14:33256266-33256288 ATCAATTTCTATAGTCAAAATGG - Intronic
1116139513 14:40972993-40973015 ATAAAGATCTTTAGGAAAAATGG + Intergenic
1116686777 14:48050548-48050570 TTCAACTTATTTAGGTAAATAGG - Intergenic
1116955114 14:50915467-50915489 GTCCACATCTTTAGGAAACAAGG + Exonic
1117060339 14:51956079-51956101 TTCAATTTTATTAGGAAAAATGG + Intronic
1117370692 14:55075898-55075920 CTCAATTACTTTAGGAAACAGGG + Intergenic
1118031013 14:61817831-61817853 GTCAAAGGCTTTAGGAAAAAAGG + Intergenic
1118055455 14:62075066-62075088 CTCAATTTCTCTAGGTAAAAAGG + Intronic
1120265922 14:82251196-82251218 AATGACTTCTTAAGGAAAAATGG - Intergenic
1120771915 14:88388342-88388364 ATCAAATTGTGTAGGAAAATGGG + Intronic
1120851186 14:89173211-89173233 TGCAACATCTTTAGTAAAAAGGG + Intronic
1121705642 14:95991349-95991371 TTCAGCTTCTTTGGGAGAAATGG + Intergenic
1122175447 14:99914719-99914741 ATGAATTTCTGTAAGAAAAATGG - Intronic
1124156660 15:27232127-27232149 ATTAATTTTTTCAGGAAAAATGG + Intronic
1125333166 15:38602023-38602045 ATGAACTGCTTCAGGGAAAAAGG - Intergenic
1127038819 15:54950377-54950399 AACAACTCCATTAAGAAAAAGGG - Intergenic
1127129124 15:55843645-55843667 CTCAATTTATTTAGGGAAAATGG + Intronic
1127837468 15:62801478-62801500 TTCAACTTTTTTGGGAAAGAGGG + Intronic
1128526624 15:68416617-68416639 ATCATCTTCTTCAAGAACAAGGG + Intronic
1129371028 15:75095279-75095301 CTCACCTTCATTAGTAAAAAGGG + Intronic
1130792558 15:87170985-87171007 ATAAACTTCTATGGAAAAAATGG + Intergenic
1133529330 16:6640246-6640268 ATCAACTTCTTGAGGAAATGTGG - Intronic
1133800905 16:9084561-9084583 ATCAACATCATTAGGCAACAGGG + Intergenic
1135483111 16:22839656-22839678 ATCAGAATCTTTAGGTAAAAGGG - Intronic
1137858297 16:51819047-51819069 AGAAACTTCTTAAGGAAATAGGG + Intergenic
1137968796 16:52962894-52962916 ATCATGTGCTTCAGGAAAAAGGG - Intergenic
1138050866 16:53775998-53776020 ATCTACTTGCTTGGGAAAAAGGG + Intronic
1138219782 16:55240783-55240805 ATCAAATTCTTTTGGAAAGTAGG + Intergenic
1140277048 16:73519073-73519095 ATCAACTTCTCGAGAATAAAGGG + Intergenic
1140781123 16:78297850-78297872 ATCAACTCCATATGGAAAAATGG - Intronic
1141243317 16:82283456-82283478 AGCCATTTCTTCAGGAAAAAGGG - Intergenic
1144268153 17:13591498-13591520 GACAACTTCTTTAGAGAAAAAGG + Intronic
1144399899 17:14886244-14886266 ATCACATTCTTTAGGAAAGGAGG - Intergenic
1145176505 17:20705113-20705135 GTGAACTTCTGAAGGAAAAAAGG + Intergenic
1146782098 17:35683380-35683402 ATAAAAGTCTTAAGGAAAAAAGG - Intronic
1148417752 17:47520657-47520679 ACAAAATTCTTTAGGCAAAAAGG - Intergenic
1148525194 17:48325577-48325599 AGCATTTTCTTTAGGAAAACAGG - Intronic
1149039245 17:52168320-52168342 ATCAAATTCATTACAAAAAATGG - Intergenic
1150500955 17:65650363-65650385 ATGAGCTTCATTAGCAAAAACGG + Intronic
1153136687 18:1925587-1925609 ATCAAAAGCTTGAGGAAAAATGG - Intergenic
1153566438 18:6422957-6422979 AGCACCTGCTTTTGGAAAAATGG + Intergenic
1153720690 18:7898885-7898907 AACTACTTCTATAGGAAATATGG + Intronic
1153762276 18:8343001-8343023 ATGAGCCTCTATAGGAAAAATGG - Intronic
1153959464 18:10128221-10128243 ATTAACTTCTTTTGGAGAAAGGG + Intergenic
1155862661 18:30923112-30923134 AAAAACCTCTTGAGGAAAAAAGG + Intergenic
1156424125 18:36990167-36990189 GTCCAGTTCTTTAAGAAAAATGG + Intronic
1156598521 18:38576058-38576080 ATCATCTTCTGTAGGAAATGTGG - Intergenic
1157519844 18:48337832-48337854 ATCAGCTTCTGTGGGAAACAGGG - Intronic
1159217154 18:65408012-65408034 AACATCTTTTTTAGCAAAAAAGG - Intergenic
1159271284 18:66154637-66154659 ATAAAGTTCTTTAGGATAAAGGG + Intergenic
1161997045 19:7719666-7719688 TTCAACTTCTCTGGGAAGAAAGG - Intergenic
1162831460 19:13286997-13287019 AACAACTGATTTAGGATAAAAGG + Intronic
1164307916 19:24021148-24021170 AACAACTTCTTCAGTTAAAAAGG + Intergenic
1164549112 19:29193456-29193478 ATCACATTCTTTAAGGAAAAGGG - Intergenic
1165181336 19:33973739-33973761 ACCACCTTATTTATGAAAAAGGG - Intergenic
1165686228 19:37822844-37822866 AACCACTTCTTTGGGGAAAAGGG - Intergenic
1167326308 19:48828159-48828181 CTCAACTTTTTAAAGAAAAAAGG + Intronic
925689173 2:6503853-6503875 AACAATTTATTTAGGAAAAAAGG + Intergenic
925750015 2:7079839-7079861 TTCAGTTTCTTTAGGAAATATGG - Intergenic
926764694 2:16314018-16314040 ATGACCTTCTTTGGAAAAAAAGG - Intergenic
927474836 2:23405245-23405267 ACTAACTTTTTTAGAAAAAATGG - Intronic
927609819 2:24527002-24527024 CTCAACTTCCTTATGTAAAATGG - Intronic
928733809 2:34262164-34262186 ATCCACATCTGTAGGAAAAGAGG + Intergenic
928867062 2:35929383-35929405 ATCATCTTCCTTAGGAAAAAAGG + Intergenic
929778171 2:44941379-44941401 ATCAACTTCTTTAGGAAAAAGGG + Intergenic
930343990 2:50155073-50155095 ATCAACTTAAATAGGAAAACAGG - Intronic
930834286 2:55776563-55776585 ACCACCTTCTTTAGAAAATATGG - Intergenic
931511895 2:63006738-63006760 ATAAAATTTTTCAGGAAAAATGG - Intronic
931642056 2:64390272-64390294 TTCAACTTCTTTATGAAATATGG + Intergenic
931643602 2:64402475-64402497 ATAAAGTTCTTTAGGGAAAGAGG - Intergenic
932710246 2:74057829-74057851 TTCAAATTCTGTAGGAAAAGTGG + Intronic
933052823 2:77621127-77621149 ATAAATTTCTTTAGGTAATATGG - Intergenic
933067223 2:77812751-77812773 ATCAACTTCTACTTGAAAAAGGG - Intergenic
933243112 2:79944997-79945019 ATAAACTTATTTATGAGAAAAGG - Intronic
933881237 2:86672013-86672035 ATAAACTTCTCTATGAGAAAAGG + Intronic
935199449 2:100843710-100843732 ATCTACTTCCTTAAGATAAATGG - Intronic
935516060 2:104040449-104040471 ATCAACTTCTTTGGGGGAAGTGG + Intergenic
937266568 2:120619367-120619389 ATCAAATTTTTTTTGAAAAAGGG - Intergenic
937406859 2:121637903-121637925 AAAAACTTTTTTAAGAAAAAAGG + Intronic
937529359 2:122809289-122809311 AGCCACATCTATAGGAAAAAGGG + Intergenic
938975006 2:136468572-136468594 ATCAACATCTGTAGCAAGAAGGG + Intergenic
939034264 2:137112067-137112089 AACAACTTCTAAAGGAGAAAGGG + Intronic
939498482 2:142951176-142951198 AGCACATTCTTTTGGAAAAATGG + Intronic
941226320 2:162854202-162854224 ATAATATTCTTTAGAAAAAAGGG - Intergenic
942262270 2:174180581-174180603 ATGACTGTCTTTAGGAAAAAAGG - Intronic
942484223 2:176422434-176422456 CTAAACTACTTCAGGAAAAAGGG - Intergenic
942554009 2:177152421-177152443 ATCTACTTCTACAGGAGAAAAGG + Intergenic
942792573 2:179777600-179777622 ATTAACTTTTCTAGGAAAAAAGG + Intronic
944154676 2:196596771-196596793 CTCCACTTCTTTCGGAACAAGGG - Intergenic
944878625 2:203988335-203988357 GACACCTTCTTTAGAAAAAAGGG + Intergenic
945106253 2:206318143-206318165 ATCAACATCTTTAGCTCAAAAGG - Intergenic
945115451 2:206403927-206403949 ACCTACCCCTTTAGGAAAAAGGG + Intergenic
945340116 2:208642473-208642495 ATGAAATTTTTTAGGAAAATAGG - Intronic
946750028 2:222884949-222884971 ATCAGCTGCATTAGGAAAACAGG - Intronic
947055595 2:226097920-226097942 TTCAACTTCTAGATGAAAAAAGG + Intergenic
948383489 2:237567360-237567382 AGCAACTTCTTTGGAAGAAAAGG + Intergenic
1169886015 20:10398759-10398781 ATCAGATTCCTTAGGCAAAATGG - Intergenic
1169886559 20:10405091-10405113 ATACACTTATTTAGGAAAAAAGG - Exonic
1169889615 20:10438158-10438180 ATGAACTTGTTTAGAAAAGAGGG + Intronic
1170161337 20:13314626-13314648 AAGAAATTCTTTAAGAAAAAAGG + Intergenic
1170406248 20:16041066-16041088 TTCAACTTCTTTTGCAGAAAAGG - Intronic
1170512602 20:17094265-17094287 ATTAACTTCCTTTGAAAAAAGGG - Intergenic
1171393119 20:24814245-24814267 ATCGACGTCTTTTTGAAAAATGG - Intergenic
1172053107 20:32134388-32134410 ATGAATTGCTTGAGGAAAAATGG - Intronic
1173051153 20:39563213-39563235 ATTAAGTTCTTTAAGCAAAATGG + Intergenic
1175595356 20:60226866-60226888 TTCAACTTCTTGAGTAATAAAGG - Intergenic
1175649052 20:60701143-60701165 ATCAAATTCTTCAATAAAAAGGG - Intergenic
1175716414 20:61257296-61257318 ATTAACTTGTTTATGATAAATGG + Intronic
1179121799 21:38553993-38554015 AACAACTTCTTTAAAAAAAATGG + Intronic
1179162237 21:38908155-38908177 TTCAGCTTCTTTGGGAAAGACGG - Intergenic
1179721222 21:43316917-43316939 ATGACCTTCTTTGGGAAAATGGG + Intergenic
1181891316 22:26066227-26066249 TCCAACTTCTTTAGGAAAATTGG + Intergenic
1183045919 22:35219939-35219961 ATCATCTTCATAAGGAACAATGG - Intergenic
1183574170 22:38676482-38676504 ATGAAAGTCTTTAGGAGAAAAGG + Intergenic
1184619913 22:45669369-45669391 CTCAACTTTTTAAAGAAAAAAGG - Intergenic
1203294653 22_KI270736v1_random:30263-30285 ATCAAATTCTTTAGAAACCATGG + Intergenic
949304744 3:2627372-2627394 GTCAACTTGTCTAAGAAAAATGG - Intronic
950032366 3:9861533-9861555 CTCAACTTCTTCAAGAAAACTGG - Intergenic
951037265 3:17947560-17947582 TTTAAGTTCTTTGGGAAAAAAGG + Intronic
951307277 3:21080726-21080748 AACATCTTTTTGAGGAAAAAGGG - Intergenic
952000241 3:28776984-28777006 TTGAACTGCTTTATGAAAAAAGG + Intergenic
952195532 3:31071873-31071895 GTCAACTTCTCTAGCAAAATTGG + Intergenic
952235500 3:31475030-31475052 GTCCACCTATTTAGGAAAAAAGG - Intergenic
952601589 3:35089491-35089513 AGCCACATCTTTAGGAAAAGGGG + Intergenic
953230168 3:41057799-41057821 AACAACTTCTTAATGAAGAAGGG + Intergenic
953516723 3:43600329-43600351 ATAAACTTCTTTTTGATAAATGG + Intronic
955444108 3:58990569-58990591 AAGATCTACTTTAGGAAAAATGG - Intronic
955847525 3:63181659-63181681 ATCACCTTCTTTTATAAAAAGGG - Intergenic
956011540 3:64836927-64836949 AGCAAGTTCTTAAGGAAAAGTGG + Intergenic
957434716 3:80159962-80159984 ATAAATATCTTAAGGAAAAAGGG - Intergenic
960223355 3:115143261-115143283 ATCAAATGCTTTTGAAAAAATGG + Intronic
960392898 3:117101069-117101091 ATCAAGGTCTTTAGGAGAAGTGG - Intronic
960504647 3:118478255-118478277 ACCAATCTCATTAGGAAAAAGGG - Intergenic
962112158 3:132463682-132463704 ATCACCTTCCTTTGGAAAAAGGG - Exonic
962727325 3:138243892-138243914 AGTAACTTCTTTGGGAAAAGTGG + Intronic
963095901 3:141539775-141539797 ATCAACTTCTCAAGAAATAAAGG - Intronic
964073948 3:152670533-152670555 ATCAACTTCTTTAGGACTTTTGG - Intergenic
965331393 3:167379174-167379196 ATCAAGATCGTTAGGAAACATGG - Intronic
965570826 3:170170598-170170620 ATCAAAGTATTTAGGAATAAAGG + Intronic
965932550 3:174063637-174063659 ATCAACTAGCTTAGCAAAAATGG + Intronic
967209149 3:187151057-187151079 AGCCACATCTATAGGAAAAAGGG + Intronic
967968636 3:194983605-194983627 ATTAAATTCTTGAGGAAACAGGG + Intergenic
968333154 3:197888981-197889003 AGCAACTTTTCTAGGAAACAGGG - Intergenic
970200277 4:13597720-13597742 TTTCACTTCTTCAGGAAAAAAGG + Intronic
970687142 4:18581399-18581421 ATAAAATTATTTAGTAAAAATGG + Intergenic
970837367 4:20426375-20426397 ATCAGATTCTTTAGAAAATAGGG + Intronic
971660044 4:29401786-29401808 ATGGACTTCATTAGGAAGAAAGG - Intergenic
972057077 4:34816346-34816368 AACAAAATCTTTAGGAAATATGG + Intergenic
973013924 4:45111267-45111289 GTCAACTTGTTTTAGAAAAATGG + Intergenic
973570496 4:52234077-52234099 ATCAAGTTCCCTAGCAAAAATGG - Intergenic
973925427 4:55732404-55732426 ACCAAATGCTTTGGGAAAAAAGG - Intergenic
976045917 4:80947169-80947191 ATCAAAATCTTTCAGAAAAAAGG - Intronic
977849949 4:101815071-101815093 ATCAACTTCATCAGTAACAAAGG - Intronic
978792164 4:112674049-112674071 TTCAATTTCCTTAGGCAAAATGG - Intergenic
979044691 4:115848258-115848280 ATCTACCACTTTTGGAAAAATGG - Intergenic
979468310 4:121067178-121067200 AAAAACTTTTTTAGGAATAATGG - Intronic
979704913 4:123709653-123709675 AGCTACTTCCTTAGGAAAAGGGG + Intergenic
979918285 4:126467628-126467650 ATAAAATTATTTAGGCAAAATGG + Intergenic
980627337 4:135390701-135390723 AACAATTTCTTTAAGGAAAAAGG - Intergenic
980660236 4:135848464-135848486 ATAAATTTCTTTGGGAAATAAGG - Intergenic
983276038 4:165618979-165619001 AACCACTTCTTAAGGAAATAAGG + Intergenic
983373067 4:166888251-166888273 TTCACATTTTTTAGGAAAAAGGG + Intronic
986612102 5:9579234-9579256 ATCAAATTTTGTAGGAAGAAAGG - Intergenic
987056637 5:14199688-14199710 ATCCCCTACTTTAGGATAAAAGG - Intronic
987576163 5:19731753-19731775 TTCAACTTCATTAAGTAAAATGG - Intronic
987895330 5:23938582-23938604 ATCAACTTATTTTTGACAAATGG - Intergenic
991235201 5:64386125-64386147 AGCAACTTCTTCAGACAAAAGGG + Intergenic
991406747 5:66307365-66307387 AGCAAATTCATTAGGTAAAAAGG + Intergenic
991452030 5:66762005-66762027 GTAAACTGCTTTAGCAAAAATGG - Intronic
991471581 5:66974981-66975003 ATTACCTTACTTAGGAAAAAAGG + Intronic
991535008 5:67660125-67660147 TTCAACTTATTTAGGAAACAAGG - Intergenic
991587077 5:68212550-68212572 TTCAGCTTCTCTAGGAAAATTGG + Intergenic
992188464 5:74266797-74266819 ATCAACTCCTTTAGGATCAATGG + Intergenic
992520231 5:77543082-77543104 AGCCACATCCTTAGGAAAAAGGG + Intronic
992593080 5:78316114-78316136 AGCAAATGCTTTTGGAAAAATGG + Intergenic
992617226 5:78556249-78556271 ATAAACTTTTCTAGGAAAATGGG + Intronic
993913306 5:93710310-93710332 TTTAACTTCTTTGGGAAAACCGG + Intronic
995138111 5:108702325-108702347 ATGAACATCTTTAGGAACAACGG + Intergenic
996203852 5:120706800-120706822 TTCAACTTCTTGGAGAAAAAAGG + Intergenic
997515501 5:134486159-134486181 ATCAACTTCTTTAGTAATGTGGG + Intergenic
998010967 5:138695341-138695363 CTCAAATTCTTAAGCAAAAATGG - Intronic
998918129 5:147038590-147038612 ATAAACTTCTAGAGGAAACAAGG + Intronic
999557357 5:152758130-152758152 ATCAAATTCATTAGACAAAAAGG + Intergenic
1000920503 5:167131679-167131701 ATCAATTTTATTAGTAAAAATGG - Intergenic
1002018257 5:176343633-176343655 ATCAACTGTTTCAGAAAAAATGG - Intronic
1002375703 5:178787717-178787739 GTGAACTTGTTTAAGAAAAAGGG - Intergenic
1003371132 6:5527771-5527793 AACAACTTCTATCTGAAAAATGG + Intronic
1004357104 6:14939422-14939444 CTCAAATTCTTTGTGAAAAATGG - Intergenic
1004633469 6:17444253-17444275 ATCAAATTATTAAGGAAGAATGG + Intronic
1005075770 6:21905393-21905415 ATCAGGTGCTTTAGGTAAAAGGG - Intergenic
1005420783 6:25647920-25647942 ATCAACTCCTTAAGAAAAGATGG + Intergenic
1005719144 6:28583608-28583630 AACAGCTTCTTTATGAAAGAAGG - Intronic
1005779255 6:29171431-29171453 ATCAAATACTATAGGGAAAATGG - Intergenic
1006194135 6:32227568-32227590 ATGAAATACTGTAGGAAAAAGGG - Intergenic
1007535369 6:42582534-42582556 ATAAAATCCTTTTGGAAAAAAGG - Intronic
1008527663 6:52422490-52422512 ATAAACTTCTTTTGCTAAAAGGG - Intronic
1008866949 6:56223927-56223949 CTCAACATCTTTGGGAAAATAGG - Intronic
1010214618 6:73390398-73390420 CTCAAATTCTTTACGTAAAATGG + Intronic
1010693151 6:78934326-78934348 ATCACCTGCTGTTGGAAAAATGG + Intronic
1010969787 6:82251025-82251047 ACCAATTTATTTTGGAAAAATGG - Intergenic
1011406038 6:87016250-87016272 ATCAACTCTTTGATGAAAAATGG - Exonic
1014064966 6:117113770-117113792 ATTAATTTTTTTAGAAAAAACGG - Intergenic
1014174644 6:118318681-118318703 TTCAAGTTCTTTAGGAAACCCGG - Intergenic
1014308957 6:119774784-119774806 ATAAAATTGTTTAGGGAAAAGGG + Intergenic
1015397350 6:132750003-132750025 ATTAACTGCTTTATTAAAAATGG + Intronic
1016295141 6:142565742-142565764 ATCTCTTTCTTTAAGAAAAAAGG + Intergenic
1016348604 6:143142822-143142844 ATCTGCTTCCTTAGGAAACATGG + Intronic
1016522219 6:144959048-144959070 ATGAATTTATTTAGGAAACATGG - Intergenic
1016636043 6:146291782-146291804 AACAACTGTTTTTGGAAAAATGG + Intronic
1016672331 6:146723350-146723372 ATCAAGTTTTTTATTAAAAATGG - Intronic
1017476808 6:154803529-154803551 ATCAACTTCTGGGGGAAAGAAGG - Exonic
1017922614 6:158885312-158885334 ATCAAGTTGTTTGGGCAAAAAGG + Intronic
1018091542 6:160349852-160349874 ATCAGGTACATTAGGAAAAAAGG + Intronic
1021359649 7:19695241-19695263 ATCTACTTTTTGAGAAAAAAAGG + Intergenic
1021415167 7:20375923-20375945 ATAAAATTCTTTAGGTAAAATGG + Intronic
1022604264 7:31793078-31793100 AGCAACTTCATTTAGAAAAATGG + Intronic
1023172293 7:37401374-37401396 ATGATCTGCTTTAGGAGAAAAGG - Intronic
1023565211 7:41517247-41517269 ATCAACTTGCTTGGGAAAAGTGG - Intergenic
1024708970 7:51994383-51994405 ATCAACCTCTTTAGCAAGATTGG + Intergenic
1027643207 7:80763850-80763872 ATCAATTTCTTTATAAAACAAGG + Intronic
1028268419 7:88758272-88758294 ATAAAATTCTTAAGCAAAAAAGG - Intergenic
1028343887 7:89756824-89756846 ATCTACTTCTTTAAGATAAAGGG - Intergenic
1028433965 7:90779956-90779978 ATCAACTTCAAGGGGAAAAAAGG - Intronic
1030449834 7:109694108-109694130 ATACACTTATTTAGTAAAAAAGG - Intergenic
1030766280 7:113413689-113413711 ATCTACTTTTTTAGGTAATATGG - Intergenic
1030985168 7:116232963-116232985 GTCATTTTCTTTAGGACAAAAGG + Intronic
1031285479 7:119861134-119861156 ATCAACTCCTGTAAGAAACAAGG + Intergenic
1031343772 7:120639015-120639037 ATAAATTTGTTTTGGAAAAATGG - Intronic
1032043667 7:128584029-128584051 ATAATCTTTTATAGGAAAAAAGG - Intergenic
1034079633 7:148264291-148264313 TTCAACTTTTTAAGTAAAAAGGG - Intronic
1036027998 8:4931631-4931653 ATCTACCTCCTTTGGAAAAAGGG + Intronic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1038103625 8:24408700-24408722 ATCCACTTTTTTAAGAAAACTGG + Intergenic
1040345106 8:46485010-46485032 ATGGCCTTATTTAGGAAAAACGG - Intergenic
1041651600 8:60308405-60308427 ATCAAGTTGTTTAGACAAAAAGG + Intergenic
1041703377 8:60817255-60817277 GTCAACTCTTTTAGGAAAAGAGG - Intronic
1042007105 8:64193399-64193421 ATCAAGTTGTTTAGTAAAAAAGG - Intergenic
1042547991 8:69967829-69967851 AGCATCTGCTTTTGGAAAAATGG - Intergenic
1042664273 8:71189298-71189320 TTTAACTACTTTAGGAAGAATGG + Intergenic
1043321304 8:78989917-78989939 ATCAAATTCTTTAGATAAAAAGG + Intergenic
1044624604 8:94224639-94224661 ATAAACTTCTTTAGGATATCTGG - Intergenic
1044796518 8:95904934-95904956 ATCAATTACTATAGAAAAAATGG + Intergenic
1044889525 8:96818451-96818473 AACAACTGCTCTTGGAAAAATGG + Intronic
1045497197 8:102718722-102718744 TTCAACTTCTTTAGTAAAATAGG + Intergenic
1045558335 8:103236648-103236670 ATGAACTTGTTAAGGAAAACTGG - Intergenic
1045724357 8:105154524-105154546 ATCTAATTGTTTAGGAAAGATGG + Intronic
1046592391 8:116221858-116221880 ATCATGTTTCTTAGGAAAAATGG + Intergenic
1046823802 8:118664633-118664655 AGCAGCTACTTTTGGAAAAATGG - Intergenic
1047045642 8:121049946-121049968 ATTTACTTCTTTAAGAAAAGAGG - Intergenic
1047117549 8:121861364-121861386 AACAACTTTTCTAGAAAAAAGGG - Intergenic
1050137090 9:2477460-2477482 CTTAACTTCTTAAGGAAAACAGG + Intergenic
1051140631 9:13975481-13975503 GGAAACTTCTTTGGGAAAAAGGG - Intergenic
1051308578 9:15743612-15743634 AGCAACTTGATTAGGCAAAAAGG + Intronic
1051469324 9:17418880-17418902 ATCAACCTCTTAACGAACAATGG - Intronic
1052142205 9:25001156-25001178 AACCATTTCTTTAGAAAAAAAGG + Intergenic
1052394752 9:27925550-27925572 TCCAACTTCTTTGGGAAATAAGG + Intergenic
1054834674 9:69664341-69664363 ATATACTCCTTTAGGAAGAAAGG + Intronic
1055288078 9:74752526-74752548 TTCAACCTCTTGAGAAAAAAAGG - Intronic
1055687914 9:78797691-78797713 ATCAACCTGTTTAGGCAATAAGG - Intergenic
1056256831 9:84808066-84808088 ATCTACTTCTTTGGGAAGGATGG + Intronic
1056411553 9:86333151-86333173 ATTAACTTGTTTAGGCAAACTGG + Intronic
1059928681 9:119239326-119239348 TAAAACTTCTTTAGGAAAATGGG - Intronic
1186437515 X:9555788-9555810 ATGAACTGCTTTAGGAAACCTGG + Intronic
1188539999 X:31238993-31239015 AAAAACTTTTGTAGGAAAAATGG - Intronic
1190844382 X:54178050-54178072 ATCTGCTTCTTTAAGAATAATGG + Intronic
1191123259 X:56927390-56927412 TGCAGCTTCTCTAGGAAAAACGG - Intergenic
1192819791 X:74632834-74632856 AGCAACTTCAGTAGGAAAAATGG - Intergenic
1192991014 X:76456212-76456234 GTCAACTTCTGTAGAAAAATTGG - Intergenic
1193148400 X:78101127-78101149 TTCAAATTTTTTAAGAAAAAAGG + Intronic
1194292356 X:92089973-92089995 ATGATCATCTTGAGGAAAAATGG - Intronic
1194498831 X:94654987-94655009 CCCAAATTCTTTGGGAAAAATGG - Intergenic
1194973363 X:100368538-100368560 TTCAGCTTCTTTTGGAGAAAAGG - Intronic
1195158996 X:102153417-102153439 ATCAACTTATATAGGAAATGGGG - Intergenic
1195765686 X:108294483-108294505 ATCAATTCCTTAAGGAACAAAGG + Intronic
1196266738 X:113657834-113657856 TTTAAATTCTTTAAGAAAAATGG + Intergenic
1196994680 X:121369124-121369146 CTCAAATTCTGTAGAAAAAAAGG + Intergenic
1197012451 X:121582772-121582794 TTGAATTTCTTTAAGAAAAAGGG + Intergenic
1197012664 X:121586137-121586159 CTCAAGTTCTTTAGCTAAAATGG - Intergenic
1197901254 X:131375325-131375347 ATGAACTTCTTCTGGAAAAATGG + Intronic
1198022979 X:132677423-132677445 ATTAACTTCTTTAAGGACAAGGG + Intronic
1198495664 X:137190099-137190121 GTTTAGTTCTTTAGGAAAAAGGG + Intergenic
1199064202 X:143394942-143394964 ATGAACATCATTAGGAATAAAGG - Intergenic
1200609864 Y:5314599-5314621 ATGATCATCTTGAGGAAAAATGG - Intronic
1200616610 Y:5387380-5387402 AGCCACATCCTTAGGAAAAAGGG - Intronic
1201544403 Y:15144925-15144947 ATCAAAAACTTAAGGAAAAATGG + Intergenic
1201570894 Y:15413159-15413181 ATAAACTTCTATAAGAAAACAGG + Intergenic
1202189903 Y:22231127-22231149 AACAACTTTTTTATGAGAAATGG - Intergenic