ID: 929780167

View in Genome Browser
Species Human (GRCh38)
Location 2:44952280-44952302
Sequence GAGAGCGCCGCGAAGGCCGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929780167_929780172 6 Left 929780167 2:44952280-44952302 CCTCCGGCCTTCGCGGCGCTCTC No data
Right 929780172 2:44952309-44952331 GGCCTTTGTCCCCACCTCTCAGG No data
929780167_929780174 11 Left 929780167 2:44952280-44952302 CCTCCGGCCTTCGCGGCGCTCTC No data
Right 929780174 2:44952314-44952336 TTGTCCCCACCTCTCAGGCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929780167 Original CRISPR GAGAGCGCCGCGAAGGCCGG AGG (reversed) Intergenic
No off target data available for this crispr