ID: 929781795

View in Genome Browser
Species Human (GRCh38)
Location 2:44961782-44961804
Sequence ATTCTTATGAATAGGCAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929781792_929781795 -7 Left 929781792 2:44961766-44961788 CCAGGTGCTGGAGGTGATTCTTA No data
Right 929781795 2:44961782-44961804 ATTCTTATGAATAGGCAGGATGG No data
929781786_929781795 12 Left 929781786 2:44961747-44961769 CCTTATTGCATTGGAATCCCCAG No data
Right 929781795 2:44961782-44961804 ATTCTTATGAATAGGCAGGATGG No data
929781791_929781795 -6 Left 929781791 2:44961765-44961787 CCCAGGTGCTGGAGGTGATTCTT No data
Right 929781795 2:44961782-44961804 ATTCTTATGAATAGGCAGGATGG No data
929781790_929781795 -5 Left 929781790 2:44961764-44961786 CCCCAGGTGCTGGAGGTGATTCT No data
Right 929781795 2:44961782-44961804 ATTCTTATGAATAGGCAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929781795 Original CRISPR ATTCTTATGAATAGGCAGGA TGG Intergenic
No off target data available for this crispr