ID: 929782664

View in Genome Browser
Species Human (GRCh38)
Location 2:44967189-44967211
Sequence CAGCACTTATAGATGTTAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 114}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929782658_929782664 -8 Left 929782658 2:44967174-44967196 CCCCTCCCTCAAAAACAGCACTT 0: 1
1: 0
2: 0
3: 29
4: 346
Right 929782664 2:44967189-44967211 CAGCACTTATAGATGTTAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 114
929782656_929782664 -1 Left 929782656 2:44967167-44967189 CCAAGACCCCCTCCCTCAAAAAC 0: 1
1: 0
2: 2
3: 43
4: 350
Right 929782664 2:44967189-44967211 CAGCACTTATAGATGTTAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 114
929782657_929782664 -7 Left 929782657 2:44967173-44967195 CCCCCTCCCTCAAAAACAGCACT 0: 1
1: 0
2: 1
3: 26
4: 397
Right 929782664 2:44967189-44967211 CAGCACTTATAGATGTTAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 114
929782659_929782664 -9 Left 929782659 2:44967175-44967197 CCCTCCCTCAAAAACAGCACTTA 0: 1
1: 0
2: 1
3: 27
4: 257
Right 929782664 2:44967189-44967211 CAGCACTTATAGATGTTAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 114
929782660_929782664 -10 Left 929782660 2:44967176-44967198 CCTCCCTCAAAAACAGCACTTAT 0: 1
1: 0
2: 2
3: 15
4: 213
Right 929782664 2:44967189-44967211 CAGCACTTATAGATGTTAGAGGG 0: 1
1: 0
2: 0
3: 12
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929782664 Original CRISPR CAGCACTTATAGATGTTAGA GGG Intergenic
903557080 1:24201926-24201948 CAGCAGTAATAGTTGTTGGATGG + Intergenic
906006087 1:42471796-42471818 CAGTATTTATAGATGATAAATGG - Intronic
908120144 1:60978737-60978759 AAGCACTTCTAGAGGTAAGATGG + Intronic
908680303 1:66653157-66653179 CAGGACTCATAGAGGATAGATGG + Intronic
908756928 1:67477609-67477631 CAGCACTTTGGGAGGTTAGAGGG + Intergenic
909966455 1:81917478-81917500 CATCTCTTGTGGATGTTAGAAGG + Intronic
911406641 1:97448783-97448805 CAGAAACTATAGATTTTAGACGG + Intronic
913968358 1:143395096-143395118 CAGCACTTGTAAATTTTGGAGGG - Intergenic
914062736 1:144220692-144220714 CAGCACTTGTAAATTTTGGAGGG - Intergenic
914116414 1:144745662-144745684 CAGCACTTGTAAATTTTGGAGGG + Intergenic
917608583 1:176662610-176662632 GAACACATATAGATTTTAGAAGG - Intronic
922510529 1:226162723-226162745 AATCACTTATAGGAGTTAGAGGG - Intronic
922700242 1:227755098-227755120 CCGCACTTAGAGATGACAGATGG - Intronic
1066700646 10:38124280-38124302 CTGAACTTATAGAGGGTAGAAGG + Exonic
1070093268 10:73310650-73310672 CAGCACTTGGAGTTGGTAGATGG - Intronic
1070763348 10:79040010-79040032 CAGATCTTACAGATGTTAAAAGG + Intergenic
1071695591 10:87865572-87865594 CAGCATTTCTAGATATTAGCTGG - Intronic
1074676323 10:115855409-115855431 CAACTCTGATATATGTTAGAAGG - Intronic
1075359083 10:121813529-121813551 CAGCACATACTCATGTTAGAGGG + Intronic
1080382899 11:31792540-31792562 CAACAATTAGAGATATTAGATGG - Intronic
1081197762 11:40181915-40181937 CACCACTTGGAGATGTGAGAGGG - Intronic
1086138559 11:83468320-83468342 CAGCATTTATACATGTTATGTGG - Intronic
1086533644 11:87816065-87816087 CATCATGTAGAGATGTTAGATGG + Intergenic
1089685807 11:120146082-120146104 CAGCACGAATAGATGGTACAGGG - Intronic
1089961443 11:122620636-122620658 CAGCACTTTGAGAAGCTAGATGG + Intergenic
1097721079 12:63022159-63022181 TAGCACTTACAAATGTTTGAAGG + Intergenic
1108441024 13:50452932-50452954 CAGCACTAACAGATGTTGCAAGG - Intronic
1109786866 13:67187470-67187492 TACCATTTAAAGATGTTAGAAGG - Intronic
1116200496 14:41788230-41788252 CAGCATTTAAAGCTGTTAGAAGG - Intronic
1117857777 14:60053110-60053132 CCTAACTTACAGATGTTAGATGG + Exonic
1120418630 14:84253503-84253525 CATCACTTATAGATGGCAGAGGG + Intergenic
1121384989 14:93511986-93512008 CAGCAAATATAGAACTTAGAGGG - Intronic
1122474606 14:101998302-101998324 CAGCTCTTATAGAGGGGAGAGGG - Intronic
1126168321 15:45672706-45672728 CACCTATTATAAATGTTAGAAGG - Intronic
1126428209 15:48552189-48552211 CAGCTTTAATAGGTGTTAGATGG + Intronic
1126920871 15:53522347-53522369 CAGCACACAAAGATGTGAGAGGG + Intronic
1131928170 15:97409271-97409293 CAGCACTAATAAATGTTTTAGGG + Intergenic
1132100201 15:99017576-99017598 AAGTTCTTATAGATGTTGGAAGG - Intergenic
1133208649 16:4249834-4249856 CAGCTCTGCTAGATGTTTGAAGG - Intergenic
1135814495 16:25619798-25619820 CATCACTTATACATTTCAGATGG - Intergenic
1140839906 16:78828929-78828951 CAAAACTTATAGAGGTTAAAGGG + Intronic
1141256391 16:82406125-82406147 CAACATTAATACATGTTAGATGG + Intergenic
1141488512 16:84356379-84356401 CAGCACCTACAGATTTTTGAAGG - Intergenic
1143924856 17:10360550-10360572 CAGCATTTATAGATGCTGGTTGG + Intronic
1149841785 17:59971548-59971570 CAGAACCTACAGATGTTAAACGG - Intronic
1156842103 18:41621096-41621118 CATCACTTATCAATGTAAGATGG + Intergenic
1157168739 18:45383015-45383037 TAGCACATATTGCTGTTAGATGG - Intronic
1157252812 18:46110588-46110610 CAGCACTTTGAGAGGTCAGATGG - Intronic
1159749971 18:72287946-72287968 CAGCACTTACAGATGTGAAGAGG - Intergenic
1161174594 19:2833585-2833607 CAGGCCTTGTAGATGTCAGAAGG + Intronic
1165432295 19:35779869-35779891 CAGCACAGAGAGATTTTAGATGG + Intronic
1165869999 19:38964898-38964920 CAGCACTTGTTCATGTTAGCAGG - Intronic
1202702145 1_KI270712v1_random:172564-172586 CAGCACTTGTAAATTTTGGAGGG - Intergenic
925758732 2:7162718-7162740 AAGCATATATAGATGATAGAAGG - Intergenic
927141648 2:20135140-20135162 CAGGACTTATGGATGGGAGAGGG - Intergenic
927380072 2:22469121-22469143 CAGCAGTTAGAGATTTTAGAAGG - Intergenic
929782664 2:44967189-44967211 CAGCACTTATAGATGTTAGAGGG + Intergenic
931647236 2:64435608-64435630 CAGCATTTACATATGTTAGAAGG + Intergenic
934115449 2:88786998-88787020 TAGAACTTATAGATGTCAGATGG + Intergenic
934173058 2:89556010-89556032 CAGCACTTGTAAATTTTGGAGGG - Intergenic
934283373 2:91630367-91630389 CAGCACTTGTAAATTTTGGAGGG - Intergenic
934628135 2:95881937-95881959 TAGAAATTATAGATGTCAGATGG - Intronic
934631198 2:95924996-95925018 CAGAAATTATAGATGTCAGATGG - Intronic
934802846 2:97183988-97184010 CAGAAATTATAGATGTCAGATGG + Intronic
934805271 2:97217715-97217737 TAGAAATTATAGATGTCAGATGG + Intronic
934832088 2:97537803-97537825 TAGAAATTATAGATGTCAGATGG - Intronic
934833357 2:97556581-97556603 CAGAAATTATAGATGTCAGATGG - Intronic
935187914 2:100751095-100751117 CAGCAGTTTTAGTTGTCAGAAGG - Intergenic
935685900 2:105682280-105682302 GAGCACTCATGGATGTTAGCCGG - Intergenic
937479972 2:122247901-122247923 ATGCATTTATAGATGTTAAAGGG - Intergenic
937850256 2:126626131-126626153 TTGCAGTTATAGATGTCAGAGGG - Intergenic
939939820 2:148336142-148336164 CAGCTCTTAGGGGTGTTAGAAGG - Intronic
940820482 2:158350153-158350175 CAGCACTGTTAGCTGCTAGATGG - Intronic
941724202 2:168843366-168843388 CAGCACTTTTTGAAGTTAGCTGG - Intronic
942527998 2:176876187-176876209 CAGCATTTAGAGGTGTCAGAAGG - Intergenic
946355910 2:219184577-219184599 CATCACTTAGAGATTTCAGAGGG + Exonic
946847151 2:223869555-223869577 CTGTCCTTATAGAAGTTAGAGGG + Intronic
948243636 2:236459900-236459922 CAGCACTTATAGTTGTCATAAGG - Intronic
948960949 2:241336663-241336685 CAGCACTTTCACATGTAAGAAGG - Intronic
1170086156 20:12534693-12534715 CAGCACCTATAGATGGTATCTGG - Intergenic
1172047960 20:32094224-32094246 AAGTACTGATAGATTTTAGAGGG + Intronic
1174076303 20:47939770-47939792 CAGCCCTAATAGAGGTCAGAGGG - Intergenic
1177507952 21:22041690-22041712 CAGCATTTATAAATGTATGAAGG + Intergenic
1179008980 21:37538638-37538660 CAGCCCTGAAAGCTGTTAGAAGG + Intergenic
1180173370 21:46073398-46073420 CAGATCTTACAGATGTTAAAAGG + Intergenic
1182806378 22:33074123-33074145 CAGCACTTGTAAATGTCAGGAGG + Intergenic
1182851535 22:33478828-33478850 TGGCACTTAAAGATGTGAGAGGG + Intronic
949170096 3:986982-987004 CAGCACTTATTCACCTTAGAAGG + Intergenic
955359053 3:58257153-58257175 CAGCACTTAGAGAGGCAAGATGG - Intronic
957343544 3:78931653-78931675 CAGCAAGTATAGATTTTAAAAGG + Intronic
961296293 3:125887153-125887175 CAGCCCTTTTGGAGGTTAGATGG - Intergenic
963716490 3:148810058-148810080 CAGCGCTTGCAGATGTCAGAAGG + Intronic
965716525 3:171610842-171610864 CAGCAATAAAAGTTGTTAGAAGG + Intronic
968206373 3:196805289-196805311 CAGCACTTTTATATGATAAAAGG - Intronic
968319720 3:197754911-197754933 CAGCACTTTTAGAGGTGAGATGG - Intronic
976298511 4:83495824-83495846 CAGCACTTTTAGAGGTTAGGCGG - Intronic
980615433 4:135216194-135216216 CAGCATTTTTAGATATTTGAGGG + Intergenic
981178772 4:141714551-141714573 TAGCACTTTTAGGGGTTAGATGG - Intronic
983734335 4:171038737-171038759 CAGATTTTATAGATGTTAAAAGG - Intergenic
987822024 5:22977826-22977848 TAGTGCTTATAGAAGTTAGAGGG + Intergenic
990007998 5:50965403-50965425 GAAAACTTATAGATTTTAGATGG - Intergenic
998991537 5:147822815-147822837 CAGCAGTTATGGATGCAAGATGG - Intergenic
999537189 5:152529936-152529958 CAGCACTTTGAGATGTGAGGGGG + Intergenic
1000296775 5:159919016-159919038 CAGAATTTATAGCTGTTTGAGGG - Intronic
1005447328 6:25938272-25938294 CATAAATTAGAGATGTTAGATGG - Intergenic
1007648644 6:43402365-43402387 CATCATTTATAGATATAAGAGGG - Intergenic
1014699415 6:124665010-124665032 CAATACTAATAGATGTTAAAGGG - Intronic
1015630948 6:135231291-135231313 CAGCTATTATAGAAGTTAGGAGG - Intergenic
1016406165 6:143733250-143733272 AATAATTTATAGATGTTAGACGG - Intronic
1022051853 7:26682701-26682723 TAGCATTTAAAAATGTTAGATGG + Intronic
1022569768 7:31440867-31440889 CAGCAGTCATAGATGTGACATGG + Intergenic
1023210737 7:37802131-37802153 CACAACTTATAAATGTTTGAGGG - Intronic
1026775157 7:73226664-73226686 CAGCACTTATTGACGCTTGAAGG + Intergenic
1027016014 7:74780035-74780057 CAGCACTTATTGACGCTTGAAGG + Intronic
1027072015 7:75165902-75165924 CAGCACTTATTGACGCTTGAAGG - Intergenic
1027355834 7:77354173-77354195 CAGCACTGACAGATATTATAAGG + Intronic
1027748985 7:82117043-82117065 CAGCCCTCATAGATGTCAGTAGG + Exonic
1043857856 8:85282005-85282027 CAGCTCTCAGTGATGTTAGATGG + Exonic
1045798872 8:106078644-106078666 CAGCACTTTTAGAGGCAAGATGG - Intergenic
1047549840 8:125858667-125858689 CAGCAATACTAGATGCTAGAAGG + Intergenic
1055175098 9:73308825-73308847 CAGCACTCAGAGATGTGACATGG - Intergenic
1055684574 9:78757344-78757366 GAGCACTTATTGATGTTAAGTGG - Intergenic
1057710379 9:97436449-97436471 AACCACTTTTATATGTTAGAAGG - Intronic
1190969074 X:55331455-55331477 CAGCACTGAGAGATATGAGAGGG - Intergenic
1193388539 X:80899406-80899428 CAGTACTTATATATGTAGGAAGG - Intergenic
1199023747 X:142912961-142912983 CAGCACTCATAGATGATTGAGGG + Intergenic
1199318836 X:146414394-146414416 CAGCATTTATAAAGGTTATAAGG + Intergenic