ID: 929784687

View in Genome Browser
Species Human (GRCh38)
Location 2:44980783-44980805
Sequence CTGTGCTTGAATAAGCCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784677_929784687 24 Left 929784677 2:44980736-44980758 CCCAGCAGATTTACTGAATCAGA No data
Right 929784687 2:44980783-44980805 CTGTGCTTGAATAAGCCTCCAGG No data
929784673_929784687 30 Left 929784673 2:44980730-44980752 CCCCACCCCAGCAGATTTACTGA No data
Right 929784687 2:44980783-44980805 CTGTGCTTGAATAAGCCTCCAGG No data
929784674_929784687 29 Left 929784674 2:44980731-44980753 CCCACCCCAGCAGATTTACTGAA No data
Right 929784687 2:44980783-44980805 CTGTGCTTGAATAAGCCTCCAGG No data
929784676_929784687 25 Left 929784676 2:44980735-44980757 CCCCAGCAGATTTACTGAATCAG No data
Right 929784687 2:44980783-44980805 CTGTGCTTGAATAAGCCTCCAGG No data
929784678_929784687 23 Left 929784678 2:44980737-44980759 CCAGCAGATTTACTGAATCAGAA No data
Right 929784687 2:44980783-44980805 CTGTGCTTGAATAAGCCTCCAGG No data
929784675_929784687 28 Left 929784675 2:44980732-44980754 CCACCCCAGCAGATTTACTGAAT No data
Right 929784687 2:44980783-44980805 CTGTGCTTGAATAAGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784687 Original CRISPR CTGTGCTTGAATAAGCCTCC AGG Intergenic
No off target data available for this crispr