ID: 929784877

View in Genome Browser
Species Human (GRCh38)
Location 2:44982235-44982257
Sequence CTGTGCTTGAATAAGCCTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784877_929784887 24 Left 929784877 2:44982235-44982257 CCTGGAGGCTTATTCAAGCACAG No data
Right 929784887 2:44982282-44982304 TCTGATTCAGTAAATCTGCTGGG No data
929784877_929784888 28 Left 929784877 2:44982235-44982257 CCTGGAGGCTTATTCAAGCACAG No data
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784877_929784890 30 Left 929784877 2:44982235-44982257 CCTGGAGGCTTATTCAAGCACAG No data
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784877_929784889 29 Left 929784877 2:44982235-44982257 CCTGGAGGCTTATTCAAGCACAG No data
Right 929784889 2:44982287-44982309 TTCAGTAAATCTGCTGGGATGGG No data
929784877_929784886 23 Left 929784877 2:44982235-44982257 CCTGGAGGCTTATTCAAGCACAG No data
Right 929784886 2:44982281-44982303 TTCTGATTCAGTAAATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784877 Original CRISPR CTGTGCTTGAATAAGCCTCC AGG (reversed) Intergenic
No off target data available for this crispr