ID: 929784880

View in Genome Browser
Species Human (GRCh38)
Location 2:44982267-44982289
Sequence GAATCAGAAACTCTGGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2958
Summary {0: 21, 1: 62, 2: 270, 3: 802, 4: 1803}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784880_929784887 -8 Left 929784880 2:44982267-44982289 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 929784887 2:44982282-44982304 TCTGATTCAGTAAATCTGCTGGG No data
929784880_929784890 -2 Left 929784880 2:44982267-44982289 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784880_929784888 -4 Left 929784880 2:44982267-44982289 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784880_929784891 -1 Left 929784880 2:44982267-44982289 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 929784891 2:44982289-44982311 CAGTAAATCTGCTGGGATGGGGG No data
929784880_929784889 -3 Left 929784880 2:44982267-44982289 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 929784889 2:44982287-44982309 TTCAGTAAATCTGCTGGGATGGG No data
929784880_929784892 0 Left 929784880 2:44982267-44982289 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 929784892 2:44982290-44982312 AGTAAATCTGCTGGGATGGGGGG No data
929784880_929784886 -9 Left 929784880 2:44982267-44982289 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 929784886 2:44982281-44982303 TTCTGATTCAGTAAATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784880 Original CRISPR GAATCAGAAACTCTGGGGTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr