ID: 929784881

View in Genome Browser
Species Human (GRCh38)
Location 2:44982268-44982290
Sequence TGAATCAGAAACTCTGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 4074
Summary {0: 23, 1: 185, 2: 539, 3: 1101, 4: 2226}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784881_929784886 -10 Left 929784881 2:44982268-44982290 CCCACCCCAGAGTTTCTGATTCA 0: 23
1: 185
2: 539
3: 1101
4: 2226
Right 929784886 2:44982281-44982303 TTCTGATTCAGTAAATCTGCTGG No data
929784881_929784887 -9 Left 929784881 2:44982268-44982290 CCCACCCCAGAGTTTCTGATTCA 0: 23
1: 185
2: 539
3: 1101
4: 2226
Right 929784887 2:44982282-44982304 TCTGATTCAGTAAATCTGCTGGG No data
929784881_929784888 -5 Left 929784881 2:44982268-44982290 CCCACCCCAGAGTTTCTGATTCA 0: 23
1: 185
2: 539
3: 1101
4: 2226
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784881_929784889 -4 Left 929784881 2:44982268-44982290 CCCACCCCAGAGTTTCTGATTCA 0: 23
1: 185
2: 539
3: 1101
4: 2226
Right 929784889 2:44982287-44982309 TTCAGTAAATCTGCTGGGATGGG No data
929784881_929784891 -2 Left 929784881 2:44982268-44982290 CCCACCCCAGAGTTTCTGATTCA 0: 23
1: 185
2: 539
3: 1101
4: 2226
Right 929784891 2:44982289-44982311 CAGTAAATCTGCTGGGATGGGGG No data
929784881_929784890 -3 Left 929784881 2:44982268-44982290 CCCACCCCAGAGTTTCTGATTCA 0: 23
1: 185
2: 539
3: 1101
4: 2226
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784881_929784892 -1 Left 929784881 2:44982268-44982290 CCCACCCCAGAGTTTCTGATTCA 0: 23
1: 185
2: 539
3: 1101
4: 2226
Right 929784892 2:44982290-44982312 AGTAAATCTGCTGGGATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784881 Original CRISPR TGAATCAGAAACTCTGGGGT GGG (reversed) Intergenic
Too many off-targets to display for this crispr