ID: 929784882

View in Genome Browser
Species Human (GRCh38)
Location 2:44982269-44982291
Sequence CTGAATCAGAAACTCTGGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1840
Summary {0: 16, 1: 78, 2: 173, 3: 399, 4: 1174}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784882_929784888 -6 Left 929784882 2:44982269-44982291 CCACCCCAGAGTTTCTGATTCAG 0: 16
1: 78
2: 173
3: 399
4: 1174
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784882_929784890 -4 Left 929784882 2:44982269-44982291 CCACCCCAGAGTTTCTGATTCAG 0: 16
1: 78
2: 173
3: 399
4: 1174
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784882_929784892 -2 Left 929784882 2:44982269-44982291 CCACCCCAGAGTTTCTGATTCAG 0: 16
1: 78
2: 173
3: 399
4: 1174
Right 929784892 2:44982290-44982312 AGTAAATCTGCTGGGATGGGGGG No data
929784882_929784887 -10 Left 929784882 2:44982269-44982291 CCACCCCAGAGTTTCTGATTCAG 0: 16
1: 78
2: 173
3: 399
4: 1174
Right 929784887 2:44982282-44982304 TCTGATTCAGTAAATCTGCTGGG No data
929784882_929784891 -3 Left 929784882 2:44982269-44982291 CCACCCCAGAGTTTCTGATTCAG 0: 16
1: 78
2: 173
3: 399
4: 1174
Right 929784891 2:44982289-44982311 CAGTAAATCTGCTGGGATGGGGG No data
929784882_929784889 -5 Left 929784882 2:44982269-44982291 CCACCCCAGAGTTTCTGATTCAG 0: 16
1: 78
2: 173
3: 399
4: 1174
Right 929784889 2:44982287-44982309 TTCAGTAAATCTGCTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784882 Original CRISPR CTGAATCAGAAACTCTGGGG TGG (reversed) Intergenic
901149724 1:7093205-7093227 CTGAATCAGAAACCCTAGGGTGG - Intronic
901803173 1:11721100-11721122 TTGCATCAGAACCCCTGGGGGGG - Exonic
901820109 1:11823530-11823552 CTGAGTCAGATCCTCTGGAGTGG + Intronic
902077292 1:13797762-13797784 CTAAACCATAATCTCTGGGGTGG + Intronic
902178644 1:14670576-14670598 CTGATTCAGTAGATCTGGGGAGG + Intronic
902182040 1:14696711-14696733 CTGATTCAGCAGGTCTGGGGTGG + Intronic
902186135 1:14726786-14726808 CTGATTCAGCAGGTCTGGGGCGG - Intronic
902207763 1:14882034-14882056 CTGATTCAGTAGCTCTGGCGTGG + Intronic
902212551 1:14914147-14914169 CTGATTCAGGAGGTCTGGGGTGG + Intronic
902216126 1:14935534-14935556 CAGAATCAGAAACTGGGGGTGGG + Intronic
902253384 1:15171121-15171143 CTGAATCAGCAACTGGGGGTGGG - Intronic
902561733 1:17281802-17281824 CTGAATCAGGACCGCTGGGGTGG - Intronic
902613401 1:17610195-17610217 CTGAATCAGAGTCCCTGGTGAGG - Intronic
902714336 1:18262066-18262088 CTGATTCAGCAGGTCTGGGGCGG + Intronic
903000066 1:20258819-20258841 CTAAATCAGAACCTCTAGGGTGG + Intergenic
903300063 1:22372406-22372428 CTGAATCAGAAACTCTGGGGTGG + Intergenic
903312824 1:22473215-22473237 CTGATTCAGAAGTTCTGGGTGGG - Intronic
903561566 1:24231911-24231933 CTGAATCAGAATGTCCAGGGTGG - Intergenic
903732048 1:25503832-25503854 ATGAATGAGAAACTCTGGGGTGG - Intergenic
903759041 1:25684947-25684969 CTGAATCAAAAACTCAGGGTGGG + Intronic
903798829 1:25951326-25951348 CTGATTCAGAAGGTCTGGAGGGG - Intergenic
903809617 1:26028174-26028196 CTAAAGCAGCAGCTCTGGGGTGG + Intronic
903860822 1:26363467-26363489 CTGAATCAAAAACTCTGGGAGGG + Intronic
903997186 1:27314687-27314709 TTAAAACAGAATCTCTGGGGTGG - Intergenic
904471365 1:30738498-30738520 CTGACTCAGGGACTCTGGTGGGG - Intronic
904543995 1:31254107-31254129 ATAAATCAGAATCTCTGAGGTGG - Intergenic
904953774 1:34266183-34266205 CTGATTCAGAAACTCGAGGTGGG - Intergenic
905214261 1:36395871-36395893 ACGAATCAGAATCTCTGGGGTGG - Intronic
905461398 1:38125215-38125237 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
905588471 1:39141318-39141340 CTGATTCAGTAGGTCTGGGGTGG + Intronic
906192725 1:43908461-43908483 CTGAATGAGAAACTCTGGTTGGG + Intronic
907009384 1:50949210-50949232 CTGAGTCAGAAACTCTGAGGTGG + Intronic
907344552 1:53764140-53764162 CTGAATCAGAAACTCTAGGCTGG + Intergenic
907488556 1:54794023-54794045 CTGAATCTAAAACTCTGGGGTGG + Intronic
907492187 1:54815278-54815300 CTGTATCAGAAGCTCTGGCATGG - Intronic
907553975 1:55328743-55328765 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
907659558 1:56379280-56379302 CTGAATCAGTAGCTCTGGATGGG - Intergenic
907659561 1:56379294-56379316 CTGATTCAGAAACTCTGACATGG + Intergenic
907748431 1:57238234-57238256 CTGAATGAGAAACTCTGGGATGG + Intronic
907771303 1:57467175-57467197 CTGAATCAGAATCTCTAGAGTGG + Intronic
907952575 1:59197784-59197806 CTGATTCAGTGAGTCTGGGGTGG + Intergenic
907963717 1:59308621-59308643 GTGACTCAGAAACACTGGGGTGG - Intronic
907982573 1:59498586-59498608 CTGAAGCAGAAACTGTGGTGTGG - Intronic
908077881 1:60540985-60541007 CTGAATTAGAAACTCGGCGTGGG - Intergenic
908116142 1:60942270-60942292 CTAAATCAGAATTTCTGGAGTGG - Intronic
908234278 1:62135090-62135112 TTAAATCTGAACCTCTGGGGTGG - Intronic
908313919 1:62913805-62913827 CTGGATCAGAATTTCTGGGTAGG + Intergenic
908699881 1:66887442-66887464 CTGAATAAAAAATTCTGTGGTGG - Intronic
908866067 1:68549596-68549618 CTGGATATGAAACTCTGGGTTGG - Intergenic
908983206 1:69983897-69983919 CTGATTCAGCAGATCTGGGGTGG + Intronic
909323380 1:74318315-74318337 CTGATTCAGTAATTCTGGAGGGG + Intronic
909344363 1:74568899-74568921 CTAAATTAGAAACTCTTGGTGGG - Exonic
909350552 1:74648031-74648053 CTGAATCAGAAGCTCTGCTAAGG - Intronic
909998741 1:82315493-82315515 CAGAATTAGAAACTCTGGGCAGG - Intergenic
910059291 1:83069096-83069118 CTGATTCAGCAAGTCTGGGATGG - Intergenic
910109663 1:83669121-83669143 CTAAATCAGAAACTCTTTGAGGG + Intergenic
910281351 1:85504896-85504918 CTGAATCAGAATTTCCAGGGAGG + Intronic
910288310 1:85577591-85577613 ACTAATCAGAAACTCTGGGGTGG + Intronic
910659880 1:89660412-89660434 TTAAATCAGAACCGCTGGGGTGG - Intronic
910859524 1:91730314-91730336 CTGAATCAGATTCTCTGGGTTGG - Intronic
911059659 1:93736974-93736996 TTGGATCAGAAGCTCTGGGATGG + Intronic
911417133 1:97589023-97589045 CTGATTCAGTAAGTCTGGGGTGG - Intronic
911446009 1:97993178-97993200 ATTAATCAGAAACTCTATGGTGG - Intergenic
911594678 1:99786724-99786746 CTGACTCAGGAACTCTGGGGTGG + Intergenic
911732992 1:101309216-101309238 GTGAATCAGAAATCCGGGGGGGG + Intergenic
912145526 1:106789587-106789609 CTGAATCAGAAACCTGGGGGTGG - Intergenic
912253924 1:108039838-108039860 CTGATTCAGTAATGCTGGGGTGG - Intergenic
912253930 1:108039852-108039874 CTGAATCAGCAATTCTGGGACGG + Intergenic
912262562 1:108123555-108123577 TTAAAGCAGAATCTCTGGGGTGG - Intergenic
912268544 1:108185576-108185598 CTGAATTAAAAACTGTGGGCAGG - Intronic
912477970 1:109953740-109953762 CTGACTCAGTAAGTCTGAGGTGG - Intergenic
912738613 1:112173098-112173120 CTGAATCAGAAGCTCTACAGTGG - Intergenic
912985427 1:114423847-114423869 CTGAATCAGAATTTCTAGGTGGG - Intronic
913122531 1:115754953-115754975 CTGAATCAGAAACTCTGGGGTGG - Intronic
913126111 1:115791904-115791926 CTGAAGCAGAGACTCCTGGGCGG + Intergenic
913290395 1:117266556-117266578 CTGATTCAGGAGATCTGGGGTGG + Intergenic
913318637 1:117573827-117573849 CTGAATTAGAAATCCAGGGGTGG - Intergenic
913385977 1:118258954-118258976 CAGAATCAGAAGCTCAGGGGAGG - Intergenic
913439955 1:118886747-118886769 CTGATTCTGTAAGTCTGGGGTGG + Intronic
915235487 1:154477592-154477614 CTCATGCAGAAACTCTGGGCTGG + Intronic
915561940 1:156692767-156692789 CTGGATAAGAATCTCTGGGCTGG - Intergenic
915658523 1:157381487-157381509 CCACATCAGAATCTCTGGGGTGG - Intergenic
915925769 1:160018274-160018296 CTGAACAAGGAAGTCTGGGGAGG - Intergenic
916007507 1:160675621-160675643 TTGAATCAGTAGGTCTGGGGTGG - Intergenic
916250749 1:162735453-162735475 ATGAATCAGAAACTCTGGTGGGG - Intronic
916489709 1:165290836-165290858 CTGAGTCAGAAGCTCAGTGGTGG + Intronic
916512859 1:165488460-165488482 TTCTATCAGAATCTCTGGGGTGG + Intergenic
916561422 1:165936825-165936847 CTGATTCAGAAACTCTGGGGAGG + Intergenic
916604497 1:166327441-166327463 CTGATTCAGGAGCTCTGGGAAGG - Intergenic
917058849 1:171014872-171014894 TGGAATCAGAAATTCTGGGGTGG + Intronic
917232013 1:172847459-172847481 CTGAATCAGAATCTGTGGATGGG - Intergenic
917296959 1:173530210-173530232 TGGAATCAGACACTCTTGGGTGG + Intronic
917571589 1:176271391-176271413 CTGAATCAGAAATACTGGATGGG - Intergenic
917640926 1:176982474-176982496 CTGATTCAGTAGGTCTGGGGTGG + Intronic
917730770 1:177872395-177872417 TTGAACCAGAATCTCTGAGGCGG - Intergenic
917905299 1:179582332-179582354 CTGAATCAGAAAATAGGGGTCGG - Intergenic
917924814 1:179780614-179780636 CTGAATCAGAAACTTGGGTGGGG + Intronic
917989637 1:180360522-180360544 ATGAATCACAAACTCTGGGGTGG + Intronic
918516221 1:185366725-185366747 CTGACTCAGTAAGTCTGGGGTGG - Intergenic
918566109 1:185934525-185934547 CTGAAAGAGAAACTTTGGAGTGG - Intronic
919094831 1:193020443-193020465 CTATATCAGAATATCTGGGGAGG + Intronic
919536285 1:198791708-198791730 CTGATTCAGGAAGTCTAGGGTGG + Intergenic
919568275 1:199216841-199216863 CTGAATATGAAATTCTGGGTTGG + Intergenic
919578302 1:199338709-199338731 CTGAATATGAAATTCTGGGTTGG - Intergenic
919780958 1:201220831-201220853 TTAAATCAGAATCTCTGGGGTGG + Intronic
919939155 1:202274620-202274642 CTGATTTAGTAAGTCTGGGGTGG + Intronic
920288204 1:204897064-204897086 CTGAATCAGCATGTCTGGGTCGG - Intronic
920670641 1:208001596-208001618 CTGAATCAAAAACTCAGGATGGG - Intergenic
920733924 1:208513934-208513956 CCAAGTGAGAAACTCTGGGGTGG + Intergenic
920802237 1:209200123-209200145 CTGAATCAGAATGTCAGGGCAGG + Intergenic
920960973 1:210663776-210663798 CTGGATCAGAAACTGTGGGGTGG + Intronic
921315850 1:213889627-213889649 CTGTTTCAGAAAATGTGGGGTGG + Intergenic
921825088 1:219663425-219663447 CTAAATTAGAAACTCTGAGATGG + Intergenic
922506259 1:226127737-226127759 CTAAATTAGAAACTCTAGGGTGG - Intergenic
922506473 1:226128929-226128951 CTGAATCAGATTCTCTAGGGTGG - Intergenic
923001647 1:230011203-230011225 CTGAGTCAGGAATTCTGGGATGG - Intergenic
924010837 1:239663809-239663831 CTGAATTAGAATCACTGGAGTGG + Intronic
924057576 1:240139022-240139044 CTGAATCAGAAACTTGGGGGTGG - Intronic
924098741 1:240582026-240582048 CTGATTCAGGAAGTCTGGGGTGG + Intronic
924546300 1:245031023-245031045 TACATTCAGAAACTCTGGGGAGG + Intronic
924612468 1:245585159-245585181 CTGAATCAGAAACTCTGGGAGGG + Intronic
924615764 1:245610407-245610429 CTGAATTGGAAACTCTGGGGGGG - Intronic
924737721 1:246773487-246773509 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
924820482 1:247485170-247485192 CTGAATCAGACACTCTGGGATGG - Intergenic
1063274543 10:4550799-4550821 CTGACTCAGAAACTCTGGGGTGG + Intergenic
1063515671 10:6692634-6692656 TTGAATCAGAAACTCAGGTTAGG - Intergenic
1063682278 10:8200034-8200056 TTGAATCAGAAACTGGTGGGAGG - Intergenic
1063784702 10:9367452-9367474 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1063817090 10:9787876-9787898 CTGATTTAGAAAGTTTGGGGTGG - Intergenic
1063941649 10:11135899-11135921 CTGAATCAGACTCTCTGGGGTGG + Intronic
1064030748 10:11881096-11881118 ATGGATCAGAAACTCTGGGGTGG + Intergenic
1064847815 10:19675525-19675547 CTGATTCATTAAGTCTGGGGTGG - Intronic
1065220892 10:23495058-23495080 CAGAGTCAGAAACTCAGGGTGGG - Intergenic
1065503827 10:26409386-26409408 CTGAATCATAATCTCAGGGGTGG - Intergenic
1065636443 10:27741017-27741039 CTGAATCCGAAACTCGGAGGTGG + Intronic
1065645587 10:27830735-27830757 CTCCATCAGGAACTCTGGGTTGG - Intronic
1065738599 10:28776115-28776137 CTGATTCAGTAAATCTGGGGTGG + Intergenic
1065784057 10:29196612-29196634 CAGAATCTGATAATCTGGGGTGG - Intergenic
1065874150 10:29982799-29982821 CTGAATCAGAAGCTCTGGGAGGG - Intergenic
1066107058 10:32165427-32165449 GTGAATCAGAATCTCTAGGCAGG + Intergenic
1067284725 10:44899228-44899250 CTGAATCACAAACTCTGGGGTGG - Intergenic
1067513448 10:46914812-46914834 CTGAATCAGTAAGTCTCGGTAGG + Intronic
1067513461 10:46914992-46915014 TTAAATCAGAATCCCTGGGGTGG - Intronic
1067648791 10:48136850-48136872 TTAAATCAGAATCCCTGGGGTGG + Intergenic
1067648804 10:48137030-48137052 CTGAATCAGTAAGTCTCGGTAGG - Intergenic
1067740469 10:48891667-48891689 CTGAATTAGAAACTAGGGTGGGG - Intronic
1068235223 10:54225182-54225204 CTGAATCAGAAGCTCTGAAAAGG + Intronic
1068335308 10:55627503-55627525 CTGAATCTGAAAAGCGGGGGTGG + Intronic
1068386388 10:56333589-56333611 CTGATTCAGAAGGTCTGGAGTGG + Intergenic
1068410884 10:56652921-56652943 CTGATTCAGTTAGTCTGGGGTGG - Intergenic
1068630299 10:59290986-59291008 CTGAACCAGAATCTCTGGAATGG - Intronic
1068797664 10:61101965-61101987 CTGAATCAGAATCTCTGGGTTGG + Intergenic
1068810884 10:61255049-61255071 CTGAATATGAAATTCTGGGTTGG + Intergenic
1068813492 10:61283294-61283316 CTGATTCAGGAGATCTGGGGTGG - Intergenic
1068976548 10:63016195-63016217 ATAAATCAGAAACTTTGGTGGGG + Intergenic
1069022627 10:63505622-63505644 CTAAATCAGAATCTCTGGGTAGG - Intergenic
1069285868 10:66714689-66714711 CTGACTCAGTAGTTCTGGGGTGG - Intronic
1069298966 10:66882988-66883010 TTAAATCAGAATCTCTGGGGTGG + Intronic
1069315993 10:67103073-67103095 CTGAATCAGAACCACTGGGATGG + Intronic
1069682979 10:70298533-70298555 CAGAATCTGAAACTCGGGGATGG - Intergenic
1069685890 10:70318257-70318279 CTACATCAGAAACTCTTGGGAGG - Intronic
1069796111 10:71053048-71053070 CTGAATGAGACACTGTGGGTGGG + Intergenic
1069850221 10:71399278-71399300 CTGATTCAGAAGGTCTGGGGTGG - Intronic
1069870343 10:71529139-71529161 CTGATTCAGTAGCTCTGGGTGGG + Intronic
1069977397 10:72225326-72225348 CTAATTCAGAAACTCTAAGGTGG - Intronic
1070276802 10:75015055-75015077 CTGAATCAGGATCTTTGGTGGGG - Intronic
1070353804 10:75619398-75619420 ATGAATGACAAACTCTGGGAGGG - Intronic
1070390097 10:75962405-75962427 CTGGATCACAAACTCTTTGGTGG + Intronic
1070501168 10:77073732-77073754 CTGAATCAGAAATGCTGGTGGGG - Intronic
1070534886 10:77369348-77369370 CTGAATAAGAATCTCTGAAGGGG + Intronic
1070541966 10:77422280-77422302 CTGAATTGGAAACTCTGGGCTGG - Intronic
1070552366 10:77500989-77501011 CGAAATCAGAAACTCTGGAGTGG + Intronic
1070553583 10:77511153-77511175 CTGAATCAGAAACTGAGGCTGGG - Intronic
1070553588 10:77511167-77511189 CTGATTCAGCAGCTCTGGGCTGG + Intronic
1070625307 10:78046934-78046956 CTGATTCAGTAATTCTAGGGTGG - Intronic
1070625313 10:78046948-78046970 CTGAATCAGAAGCTGTGGGTGGG + Intronic
1070752252 10:78971168-78971190 CTGAAGCAGAGACTCTGGGGTGG + Intergenic
1070994101 10:80760599-80760621 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1071264558 10:83953400-83953422 CTAAATCAGAATCTCTGCAGGGG + Intergenic
1071369800 10:84939686-84939708 TTGAATCAGAAGCTTGGGGGTGG + Intergenic
1071575354 10:86721731-86721753 GTGAATCAGAAACTCTGGAGGGG + Intronic
1071733543 10:88272484-88272506 CTGAATTAGAATCCCTGGAGAGG - Intergenic
1071786985 10:88912188-88912210 CTGATTCAGCAGGTCTGGGGTGG - Intronic
1071831778 10:89379313-89379335 CTGACTCAGAAACTCTAGGGTGG + Intronic
1072047709 10:91673248-91673270 ATGGATCAGAAACTGTGGTGGGG - Intergenic
1072307660 10:94122827-94122849 CTGAATCAAAAACTCTGGGCTGG - Intronic
1072448024 10:95516224-95516246 CTGATTCAGAAGCTCTAGGGTGG - Intronic
1072449291 10:95526567-95526589 CTGAATCAGCAGGTCTGGGGTGG + Intronic
1072622288 10:97088110-97088132 TAAAATCAGAATCTCTGGGGTGG - Intronic
1072895285 10:99361003-99361025 CTAAAACAGAATCTCTAGGGTGG + Intronic
1072908949 10:99483145-99483167 CTCATTCAGTAAGTCTGGGGTGG - Intergenic
1073420354 10:103419316-103419338 CTGAATTAGAAACTTTGGTGTGG - Intronic
1073591641 10:104763148-104763170 CTGAATGAGAAACTCAGGGTGGG + Intronic
1073689641 10:105793540-105793562 TTTAATCAGAATCTCTGTGGGGG + Intergenic
1073722650 10:106191003-106191025 CTGATTCAGTAAGTCTGGAGAGG - Intergenic
1074520705 10:114220023-114220045 CAAAATTAGAAACTCTGGGTAGG + Intronic
1074534027 10:114315815-114315837 CTGAAGCAGCATCGCTGGGGAGG + Intronic
1074777051 10:116774478-116774500 CTGACCCAGAGACTCTGGGTAGG + Intergenic
1074782363 10:116811209-116811231 CAGAAACAGAAACACTGGTGTGG + Intergenic
1074958555 10:118417260-118417282 CTAAATCAGAATCCCTGAGGTGG - Intergenic
1075006466 10:118833965-118833987 CTGAATCAGAAACTTGGGGTAGG + Intergenic
1075213386 10:120510948-120510970 CTGCTGCAGCAACTCTGGGGTGG + Intronic
1075223159 10:120601813-120601835 CTAACTCAGTAGCTCTGGGGTGG - Intergenic
1075386615 10:122059910-122059932 CTGAACTAGAAACTCAGGGTGGG + Intronic
1075430972 10:122380749-122380771 TTAAATCAGAAATTCTGGGATGG - Intronic
1075437384 10:122455063-122455085 TTGAATCAGAAATTCTGGAGTGG + Intronic
1075571065 10:123546048-123546070 CTGAATCAGAAACTTGGGACAGG - Intergenic
1075646284 10:124099001-124099023 CTGAATCAGAGTGTCTGGGGTGG + Intergenic
1076025368 10:127107668-127107690 CTAATTCAGAAGGTCTGGGGAGG - Intronic
1076909777 10:133381177-133381199 GTGAGTCAGGAACTCTGTGGTGG + Intronic
1077524046 11:3053689-3053711 CCAAATCAGAATCTCTGGGGTGG + Intronic
1078045562 11:7911395-7911417 CTGAATCCAAATCTCTGGGGAGG + Intergenic
1078099163 11:8319513-8319535 CTGAGGCAGAAACGCTGGGATGG + Intergenic
1078370740 11:10742638-10742660 CTGAATCAGAAACTGTGAGCGGG + Intergenic
1078390920 11:10934682-10934704 CTGAAAGAGGAGCTCTGGGGTGG - Intergenic
1078454140 11:11462089-11462111 CTGAATGAGAAACTCTGGGGTGG - Intronic
1078648310 11:13163393-13163415 TTCAATCAGAATCTCTGGGTAGG + Intergenic
1078777927 11:14410799-14410821 CTGAATCAGAAACGCTGGGGTGG + Intergenic
1078962993 11:16301481-16301503 CTAAATCAAAAACTCTGGGATGG - Intronic
1079417984 11:20258203-20258225 CTGAATCAGAATCTCTGGGGTGG - Intergenic
1079509475 11:21194450-21194472 CTAAATCAGAATCTCTATGGGGG - Intronic
1079788683 11:24708664-24708686 CTGAATAAGAATCTCTTGTGGGG - Intronic
1080054008 11:27886462-27886484 CTAAATCAGAATCTCTGAAGAGG - Intergenic
1080242229 11:30139841-30139863 TTGAATCAGAAATTTTGGGGTGG - Intergenic
1080249313 11:30215243-30215265 CTAAATCAGAAACTCTGGGGTGG - Intergenic
1080425883 11:32153905-32153927 CTGAATCTGTAAGTCTGGGTGGG + Intergenic
1080442337 11:32306236-32306258 CTGAATCAAAAAGTCAGGGCTGG + Intergenic
1080603096 11:33840009-33840031 CAGATTCAGTAACTCTGGGTTGG + Intergenic
1080629978 11:34065453-34065475 CTGAATCAGAAACTCAGTGGTGG - Intronic
1080757380 11:35215090-35215112 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1080873104 11:36253976-36253998 CTGATTCAGTAGGTCTGGGGAGG + Intergenic
1081451332 11:43173232-43173254 TTAAATCAGAACCTGTGGGGAGG - Intergenic
1081461692 11:43278353-43278375 CTGATTCAACAGCTCTGGGGTGG + Intergenic
1081535626 11:43993984-43994006 ATGCATCAGGAACTCTGGGATGG - Intergenic
1081585834 11:44382967-44382989 CTGACTCCAGAACTCTGGGGTGG - Intergenic
1081613150 11:44575507-44575529 CAGAATCAGAAACCTGGGGGTGG - Intronic
1081657493 11:44867182-44867204 CTGAATCAGAAACTTGAGAGTGG + Intronic
1081768040 11:45626076-45626098 CTGAACCAGTAAGTCTGGGATGG + Intergenic
1081836493 11:46159867-46159889 CAGAATCAGACTCTCTGGGTGGG - Intergenic
1081932960 11:46885297-46885319 CTGATTCAGTAAGTCTAGGGTGG + Intronic
1082218261 11:49601158-49601180 CTGATTCACAAAATCTGGGGTGG - Intergenic
1083230176 11:61312423-61312445 CAGAATCAGAAACTCTGGGAGGG - Intronic
1083406174 11:62458833-62458855 CTGAATCAGACACTCTAGGGTGG + Intronic
1083570671 11:63760788-63760810 CTGAATCAGAAACTTGGTTGGGG - Exonic
1083660458 11:64249579-64249601 TTGAAGCAGAGGCTCTGGGGAGG + Intergenic
1083851324 11:65369126-65369148 CTGAACCAGAAACTCGAGGGTGG + Intergenic
1083900908 11:65642870-65642892 CTGATTCAGATGGTCTGGGGTGG - Intronic
1084143704 11:67251625-67251647 TTAAATCAGAACCTCTTGGGTGG + Intronic
1084234428 11:67777574-67777596 CTGAGGCAGAAACTGTGGGCAGG + Intergenic
1084292364 11:68182346-68182368 CTGATTCAGTAGCTTTGGGGTGG - Intronic
1084454306 11:69258702-69258724 CTGATTCAGCAAGTCTGAGGAGG - Intergenic
1084612491 11:70212497-70212519 AGGAATCTGAAACCCTGGGGCGG - Intergenic
1084776002 11:71376063-71376085 CTGATTGAGAAATGCTGGGGTGG + Intergenic
1084782267 11:71418007-71418029 CTGAATGAGAAACGCTGGGTGGG + Intergenic
1084991278 11:72927595-72927617 CTGAATCAGAGACTCTGGGTGGG - Intronic
1085173744 11:74469072-74469094 CTGAATTAGAACCTCTGGAGTGG - Intergenic
1085316347 11:75547552-75547574 ATGAATCAGAAACTCTGGCTGGG - Intergenic
1085442599 11:76578048-76578070 CTGATTCAGCAGGTCTGGGGCGG + Intergenic
1085457849 11:76675375-76675397 CTGAACCAGACTCTCTGGGATGG - Intergenic
1085659869 11:78353958-78353980 CTGAATCACAAATTCTAGGCTGG - Intronic
1085821896 11:79802749-79802771 CTCATTCAGAAGGTCTGGGGTGG + Intergenic
1086190107 11:84069105-84069127 CTGAATCAGCACCTCTGGAGGGG - Intronic
1086212817 11:84341514-84341536 TTAAATCATAATCTCTGGGGAGG - Intronic
1086339198 11:85830165-85830187 TTGACTCAGAAACTCCGGAGTGG - Intergenic
1086594556 11:88555312-88555334 CTGAATCAGAAACTCTGGGTTGG + Intronic
1086843497 11:91718675-91718697 CTGAATTAGAAACCCTGGTGAGG - Intergenic
1086899037 11:92345512-92345534 CAGAGTCAGAAACTCTGCAGTGG + Intergenic
1086912431 11:92488471-92488493 CTGAGTAAGAAACTCAGGGCTGG - Intronic
1087024827 11:93639471-93639493 TTAAATCAGAATCTTTGGGGTGG - Intergenic
1087024940 11:93640596-93640618 CTAAATCAGCAAGTCTGAGGTGG - Intergenic
1087140387 11:94760003-94760025 CCAAATCAGAAACTCTGGAGCGG + Intronic
1087822557 11:102728800-102728822 CTGAATCAGAATCTCTGGGGTGG + Intergenic
1087949290 11:104200422-104200444 TTAAATCAGGAACTCTGGGAGGG + Intergenic
1087970360 11:104473607-104473629 CTGAGTCAGAAACTCTGGGGTGG - Intergenic
1088450500 11:109976808-109976830 CTGAATGAGAAATTCTAGGGTGG + Intergenic
1088496513 11:110436594-110436616 GTGACTCAGTAAGTCTGGGGCGG - Intronic
1088574029 11:111252339-111252361 CCGAATCAGAAACCCTAGGGTGG - Intergenic
1088581207 11:111318560-111318582 ATGAATCACAACCTTTGGGGTGG + Intergenic
1088657506 11:112014656-112014678 CTAAATGATAAACTCTTGGGAGG + Intronic
1089024728 11:115257870-115257892 CTGAATCTGAAACCCTGGGAAGG - Intronic
1089368574 11:117936439-117936461 GTGAAACAGAAAATCTGAGGGGG + Intergenic
1089635849 11:119811169-119811191 TTGAGTCAGACACTCTGGGTGGG - Intergenic
1089787620 11:120919516-120919538 CTTAACCTGAAACTCTGGGGTGG + Intronic
1089794045 11:120966263-120966285 CTGATTCTCACACTCTGGGGTGG + Intronic
1089811632 11:121136747-121136769 CTGACTCAAAGACTCTGGAGAGG - Intronic
1089835440 11:121366342-121366364 CTGAGTAAGAAAGTCTGGGGTGG - Intergenic
1089951602 11:122533378-122533400 CTGATTCAGTAGATCTGGGGTGG + Intergenic
1090344181 11:126054674-126054696 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1090398792 11:126435476-126435498 CTGACTTAGAGACTCTGGAGGGG + Intronic
1090474652 11:127008839-127008861 CTGAATCAAAACCTCTGAGGTGG + Intergenic
1090477000 11:127032126-127032148 CTGATTCAGTAAATCTGGAGGGG - Intergenic
1090728136 11:129545939-129545961 TTAAAACAGAAATTCTGGGGTGG - Intergenic
1090824068 11:130371260-130371282 CTGAATCAGAATCTCCCAGGAGG - Intergenic
1090851298 11:130572774-130572796 CTGAATGAGGAAGTCTGGAGTGG - Intergenic
1090916268 11:131165737-131165759 ATCAATCAGAATCTCAGGGGTGG + Intergenic
1091028665 11:132163840-132163862 CTGAGTCAGAATTTCTGAGGAGG - Intronic
1091261002 11:134234058-134234080 CTGAATCAGAAACACTAGGGTGG + Intronic
1091504210 12:1050484-1050506 CTAAACCAGAAACTTTGGGAGGG - Intronic
1091673129 12:2467246-2467268 CTGAATCCGAATGTCTGGGTGGG + Intronic
1091743734 12:2977622-2977644 ATGAAACAGAAGCTTTGGGGAGG + Intronic
1091805271 12:3351454-3351476 CTAATTCAGTAAGTCTGGGGTGG + Intergenic
1091806249 12:3358304-3358326 CTGACTCAGTAACTCTTGGGAGG - Intergenic
1091828448 12:3532791-3532813 ATGAATCAGAAATTTTGGGACGG - Intronic
1091960310 12:4688666-4688688 CTGATTCAGTAGGTCTGGGGTGG - Exonic
1092155009 12:6276451-6276473 CTCAATCGGAATCTCTTGGGAGG + Intergenic
1092234372 12:6797072-6797094 CTGAATCAGAAACTGGGGGTGGG - Intronic
1092234382 12:6797086-6797108 CTGATTCAGCAGGTCTGGGGTGG + Intronic
1092351355 12:7758516-7758538 CTGAATCAGAAATTCTGGGGTGG + Intergenic
1092380576 12:7993460-7993482 CTGACTCAGCAAATCTGGCGTGG + Intergenic
1092480978 12:8858707-8858729 CTGAATGAGAAACTCTGGGAGGG + Intronic
1092644733 12:10558000-10558022 CTGAATCAGAAACTCTGAAATGG + Intergenic
1092896251 12:13013430-13013452 CCAAATCAGAATCTCTGGGACGG + Intergenic
1093133250 12:15417570-15417592 CTGATTTAGTAAGTCTGGGGTGG - Intronic
1093657864 12:21717711-21717733 CTAAATCAGAATTTCTGGGGAGG + Intronic
1093749699 12:22784025-22784047 ATGAATCACAAACTTTGGGGTGG - Intergenic
1093901386 12:24638140-24638162 CTGAATCAGAATATCTGGTGAGG + Intergenic
1094059094 12:26294429-26294451 CTCATTCAGTAAGTCTGGGGTGG - Intronic
1094166246 12:27446818-27446840 CTGATTCAGTAAGTCTGGGAGGG + Intergenic
1094286972 12:28806378-28806400 CTGAATCAGAAACTGGGGGTAGG + Intergenic
1094501952 12:31029493-31029515 TTGAATCAGAAACTTGGGTGTGG + Intergenic
1094635072 12:32218375-32218397 CTGAATCAGAATCTCTGCGAGGG - Intronic
1094697931 12:32840130-32840152 CTGATTCAGAAGGTCTGGGGTGG + Intronic
1094788480 12:33880500-33880522 CTGAATGTGAAATTCTGGGTTGG + Intergenic
1095180397 12:39141585-39141607 CTGAATCAAAAATTCTGGGGTGG - Intergenic
1095417343 12:41990992-41991014 CTGACTCAGAAACTCTGAGGTGG + Intergenic
1095418291 12:41999082-41999104 CTGAATTAGGAACTCTGGAGTGG - Intergenic
1095797546 12:46236825-46236847 CTGATTCTGTAAGTCTGGGGTGG - Intronic
1095988356 12:48016066-48016088 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1096385851 12:51194977-51194999 CTGAATAAGAAACTCTGAGGTGG + Intronic
1096585540 12:52617388-52617410 CTGATTCAGTTGCTCTGGGGTGG + Intronic
1096689172 12:53308924-53308946 CTGATTCACAGACACTGGGGAGG - Intronic
1096801026 12:54110560-54110582 CTGACTCAGTAGATCTGGGGTGG + Intergenic
1096857652 12:54496505-54496527 CTGAATCCAAAATTCTGGGGTGG - Intergenic
1097158642 12:57030079-57030101 CTGGATCAGAGACTCTGAGGAGG + Intronic
1097780656 12:63700172-63700194 CTGAGACAGAAACTCTAGGATGG - Intergenic
1097972601 12:65650576-65650598 TTGATTCAGTAAGTCTGGGGTGG - Intergenic
1098136205 12:67405111-67405133 CTGATTCAGGAAGTCTGGGGTGG + Intergenic
1098191238 12:67951254-67951276 ATGAATCAGAACCACTGGTGTGG + Intergenic
1098342598 12:69468285-69468307 ATGAATCAGAAGCTCTGGGGTGG - Intergenic
1098342605 12:69468299-69468321 CTGATTCATAAGATCTGGGGCGG + Intergenic
1098530253 12:71533495-71533517 CTAAACCAGAAACTTTGGGATGG + Intronic
1099173294 12:79391224-79391246 TTGAATCAGGATCACTGGGGTGG - Intronic
1099543384 12:83944282-83944304 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1099974471 12:89532334-89532356 CTGAAACAGAAACTCTGGAGTGG - Intergenic
1100405214 12:94266920-94266942 CTGAATCAGAATCTCTGGGGAGG + Intronic
1100547371 12:95615893-95615915 CTGAATCAGAATTTTTAGGGTGG + Intergenic
1100632697 12:96404153-96404175 CTGAATCAGAAACTCTAGTGTGG + Intergenic
1101115929 12:101531143-101531165 CTGAATCAGAAACTCATGGTGGG - Intergenic
1101178331 12:102181024-102181046 CTGAATCCAAAACTATAGGGTGG + Intronic
1101210108 12:102526825-102526847 CTGACTCAGTCACTCTGGGATGG + Intergenic
1101538611 12:105643508-105643530 CTGAAACTGAACCTATGGGGTGG - Intergenic
1101759088 12:107644576-107644598 CAGAATCAGAAACTCTGGGGTGG - Intronic
1101760228 12:107652240-107652262 CTGAATCAGAAACTTGAGGGGGG + Intronic
1101961321 12:109252705-109252727 CTGAATCAGAAACACTAGCTAGG + Intronic
1102060639 12:109928411-109928433 CTGGTTCAGCAGCTCTGGGGTGG - Intronic
1102545366 12:113650643-113650665 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1102724147 12:115043864-115043886 CAAAGTCAGAAACTCTGGAGGGG - Intergenic
1102922713 12:116804311-116804333 CTGAATCAGTAGGTCTGGGGTGG - Intronic
1102922719 12:116804325-116804347 CTGATTCAGAAACTGTGAGGTGG + Intronic
1102927639 12:116838803-116838825 CTGGATTAGAAATTCTTGGGAGG + Intronic
1103005565 12:117417593-117417615 CTGATTCAGAAGATCTGGGTGGG - Intronic
1103239449 12:119400659-119400681 GTGAACCAGAACCTCTGGTGTGG - Intronic
1103290327 12:119840351-119840373 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1103370854 12:120418222-120418244 CTGCATCAGATACTTTGGGATGG - Intergenic
1103439885 12:120955231-120955253 CTGAATCAGAAACTCGGGGTGGG - Intergenic
1103959637 12:124600945-124600967 CTGAATCGGACACTCGGGAGAGG - Intergenic
1104156365 12:126136688-126136710 CTGAAGCAGGACCTCTGGGCTGG + Intergenic
1104403934 12:128501926-128501948 CTGAGTCAGTAGTTCTGGGGAGG + Intronic
1104520423 12:129469409-129469431 CTGAATCAGAAATTCTGGAGGGG + Intronic
1104545967 12:129713162-129713184 CTGAATCAGTGGGTCTGGGGAGG - Intronic
1104657286 12:130582716-130582738 CTGAATCAGAAACTGGAGGAGGG + Intronic
1105248306 13:18673004-18673026 CTGAATCAGAAGCTCTGGGGTGG + Intergenic
1105574484 13:21637411-21637433 CTGACTCACAGCCTCTGGGGTGG + Intergenic
1105628011 13:22132622-22132644 CTGAATAAGAAAATTTGGGTGGG + Intergenic
1105967654 13:25399255-25399277 CTGATTCAGGAAGTCTGGGATGG + Intronic
1105982052 13:25527357-25527379 CTGATTCAGTACGTCTGGGGTGG - Intronic
1106225120 13:27779785-27779807 GGGAAGCAGAAACTCTGGGTGGG - Intergenic
1106286273 13:28320698-28320720 CTGAGTCAGTAACTCTTGGGTGG - Intronic
1106303084 13:28486997-28487019 CTGAATGAGAAACTCTGGGGTGG + Intronic
1106317626 13:28609018-28609040 CTGAATCAGAAACGGTGTGGTGG + Intergenic
1106506779 13:30377253-30377275 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1106635533 13:31524979-31525001 TTGAATCAGAAACTCTGGGGTGG - Intergenic
1106771853 13:32969056-32969078 CTCAATCAGAATATCTAGGGTGG - Intergenic
1106976999 13:35230885-35230907 CTGAATCAGAGACTAGGGTGGGG + Intronic
1107199580 13:37698077-37698099 CTGAATCAGATACTGGGGTGGGG - Intronic
1107279994 13:38722599-38722621 CTGAATTAGACACTCTGGGGTGG - Intronic
1107525277 13:41224632-41224654 TTACATCAGAATCTCTGGGGTGG + Intronic
1107755279 13:43614904-43614926 CTGATTCAGTAGTTCTGGGGTGG - Intronic
1108001541 13:45909658-45909680 TTGGATCAGAAGGTCTGGGGCGG - Intergenic
1108012994 13:46040032-46040054 CTGAATCAGAATTTCTGGGTTGG - Intronic
1108225104 13:48281297-48281319 CTGAATCAGAAACTCTGAGGTGG - Intergenic
1108225110 13:48281311-48281333 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1108314936 13:49227628-49227650 CAGAATCAGAACTTCTGGAGTGG - Intergenic
1108379678 13:49844035-49844057 CTGAGTCAGAAACTCGGGGTGGG + Intergenic
1108524133 13:51271568-51271590 CTGAAACAGAATCTCCGGGGTGG - Intronic
1108771851 13:53712071-53712093 CTGAATAAAAAACTCTGGGAAGG + Intergenic
1108794952 13:54019449-54019471 CTGAATAAGAAACTCTGGAATGG - Intergenic
1108944963 13:56010815-56010837 CTGATTCAGAAATTCTGTGGTGG + Intergenic
1109666873 13:65551709-65551731 CTGAATATGAAATTCTGGGTTGG + Intergenic
1109728450 13:66377314-66377336 CTGAATCAGAAACTCAGGGCGGG - Intronic
1110366632 13:74694079-74694101 CTGATTTAGAAAGTCTGGGAAGG - Intergenic
1110369731 13:74726510-74726532 CTGAAACAGAAACTCTGGATTGG + Intergenic
1110370254 13:74731898-74731920 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1110507078 13:76299381-76299403 CTAAATCAGAAACTCTGGGAAGG + Intergenic
1110525862 13:76536248-76536270 TTGAATCCAAAACTCTGGTGGGG - Intergenic
1110648549 13:77917744-77917766 CTGAATCAGAAACTCTGGAGTGG - Intronic
1110762537 13:79246104-79246126 CTGAAGCAGAGGCTCTGGGGTGG + Intergenic
1110897859 13:80778457-80778479 ATGAATCAGAAACTGTAGGGTGG - Intergenic
1111115196 13:83767417-83767439 CTGATTGAGAAGGTCTGGGGTGG + Intergenic
1112245184 13:97726896-97726918 CTGAATCAGACACTGGGGGATGG + Intergenic
1112336796 13:98523055-98523077 CTGAATCAGAAATTCTTCGTAGG - Intronic
1112366007 13:98756060-98756082 CTGATTCAGTAGCTCTGGGGCGG - Intergenic
1112366011 13:98756074-98756096 CTGAATCAGAACGTCTGCAGTGG + Intergenic
1112416213 13:99205486-99205508 CTGAATCTGACCCTCTGGGGAGG - Intronic
1112559702 13:100501916-100501938 CTGAATTGGAAACTCAGGTGGGG + Intronic
1112827137 13:103404659-103404681 CTGATTCAGCAGATCTGGGGTGG + Intergenic
1113125885 13:106979131-106979153 CTGAATCAGAAGTTCTGATGGGG - Intergenic
1113265843 13:108617226-108617248 CTGCATCCAAATCTCTGGGGTGG - Intronic
1113271720 13:108682014-108682036 CTAAATCAGAAACTGGAGGGTGG + Intronic
1113408318 13:110062251-110062273 CTGAGTCAGAAACTCTGGCAGGG - Intergenic
1113757423 13:112822894-112822916 CAGAACCTGAAACCCTGGGGTGG - Intronic
1113914042 13:113860596-113860618 CTGAATTAGAAACTCGGGCAAGG + Intronic
1114768889 14:25406564-25406586 CAGAACTGGAAACTCTGGGGTGG + Intergenic
1114806877 14:25847810-25847832 CAGAAACAGACACTCTGGAGGGG - Intergenic
1115654342 14:35429070-35429092 CTGAATCAGAAACGGGGGTGGGG + Intergenic
1115727219 14:36230123-36230145 CTGATTCAGTAAGTCTGGTGTGG + Intergenic
1116818872 14:49608736-49608758 CTGAATCAGAAACTGAGAGTGGG + Intronic
1116999919 14:51361909-51361931 CAGACTCAGTAATTCTGGGGTGG + Intergenic
1117093902 14:52277753-52277775 TTGAATCAGAATCTCTTGGGTGG + Intergenic
1117181062 14:53192191-53192213 CTGAATCAGGAACTCTGGGGTGG + Intergenic
1117659559 14:57989310-57989332 CTGAATGAGAAACTCCGGGGTGG + Intergenic
1118912078 14:70069874-70069896 CTGATTCAGTAGATCTGGGGTGG + Intronic
1118912799 14:70075897-70075919 CTGAGTCACAAACTCTGGGATGG - Intronic
1119192969 14:72696833-72696855 CTGATTCAGTCAGTCTGGGGTGG - Intronic
1119231164 14:72980910-72980932 CTGAATTAGAAACTGTGGAGGGG + Intronic
1119261681 14:73241461-73241483 CTGCATGACAACCTCTGGGGTGG - Intronic
1119436495 14:74600899-74600921 CTGATTCAGCAGATCTGGGGTGG - Intronic
1119497812 14:75095933-75095955 TTAAATCAGAATCTCTGGGGTGG - Intronic
1119615458 14:76096008-76096030 GGGAATCAGAATCTCTGGGGTGG + Intergenic
1119893471 14:78200476-78200498 CAGATTCAGGAAGTCTGGGGTGG - Intergenic
1119968656 14:78944877-78944899 CTGATTCAGAAGATCTGGGATGG - Intronic
1120009870 14:79401412-79401434 CTGAGTCAGTAAGTCTGGTGTGG - Intronic
1120009872 14:79401426-79401448 CTGACTCAGAAACTCTGACGTGG + Intronic
1120236861 14:81902896-81902918 CTCATTCAGAAATTCTAGGGAGG + Intergenic
1120491539 14:85184588-85184610 CTGAATCAGAAGCTCTAAGGTGG - Intergenic
1120909559 14:89653724-89653746 CTGACTCAGTAAGTGTGGGGTGG + Intergenic
1121059335 14:90890535-90890557 CTGATTCAAGAGCTCTGGGGCGG + Exonic
1121179953 14:91921555-91921577 CTGACTCAGTAGGTCTGGGGTGG - Intronic
1121214438 14:92236380-92236402 CTGAATTCGAAAGTCTGGGAGGG - Intergenic
1121225886 14:92321988-92322010 CTGACTCAGTAGGTCTGGGGTGG + Intergenic
1121226552 14:92325373-92325395 CTGACTCAGCAGGTCTGGGGTGG - Intronic
1121230570 14:92354667-92354689 CTGATTCAGTAGATCTGGGGTGG + Intronic
1121445954 14:93979084-93979106 TTAAATCAGAATCTCTGGGGTGG - Intergenic
1121702291 14:95963677-95963699 CTGAGTCAGGAGCTCTAGGGGGG - Intergenic
1121746967 14:96304182-96304204 CTGAATCAGAAACTCTGGGGTGG + Intronic
1121837779 14:97107284-97107306 CTGATTCAGCAGCTCTGGGTGGG + Intergenic
1121906714 14:97752763-97752785 GTGAATCAGAAACTCTGAAGTGG + Intronic
1121970795 14:98354349-98354371 CTGAAGGAGAAACTCAGGAGTGG - Intergenic
1122215301 14:100199682-100199704 CTGAGTCAGAGACTCTGGGAGGG - Intergenic
1122215308 14:100199696-100199718 CTGACTCAGCAGCTCTGGGGTGG + Intergenic
1123791947 15:23730424-23730446 CTGAGTAAGAAACACTGGTGAGG - Intergenic
1124070150 15:26384097-26384119 CTCAATCAGCATCTCTGGGTTGG - Intergenic
1124505444 15:30268698-30268720 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1124738108 15:32269933-32269955 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1124914645 15:33957974-33957996 CTAAATCTGAAACTCTGAGTGGG + Intronic
1125289840 15:38133886-38133908 CTGAATCAGAAACTCTGGAGGGG - Intergenic
1125735638 15:41923547-41923569 CTGATTCAGTGGCTCTGGGGAGG - Intronic
1125799659 15:42434183-42434205 CTGGATCAGAAACTCTGGCAAGG + Intronic
1125961007 15:43829939-43829961 CTGAATCAGAAACTGTTGGTGGG - Intronic
1126087307 15:45022543-45022565 CTGTATCAGAATCTCTGTGCTGG + Intergenic
1126168343 15:45672942-45672964 CTGAATCAGAAACTGGGAGCAGG - Intronic
1126197312 15:45946659-45946681 CTGATTCGGTAAGTCTGGGGTGG - Intergenic
1126484126 15:49160415-49160437 CTGAATCAGAATCTCTACTGTGG - Intronic
1126644592 15:50862176-50862198 CTGGAACACAAACTCTGGGAAGG + Intergenic
1127070030 15:55279974-55279996 CTGAATCTGAAACTCTGGTGGGG - Intronic
1127107070 15:55627886-55627908 CTGACTCACTAAGTCTGGGGTGG + Intronic
1127180616 15:56412844-56412866 ATGTATCAGAATCTCTGGGAGGG + Intronic
1127209467 15:56758291-56758313 CTGAATCAGTAGGTCTGGGATGG + Intronic
1127283089 15:57508830-57508852 CTGACTCAGGAAGTCTGGAGTGG - Intronic
1127302396 15:57667879-57667901 CTGAAACAGAATCTTTGGTGGGG - Intronic
1127361826 15:58251206-58251228 CTGAATCAGCATCTCTGGATTGG - Intronic
1127378804 15:58409943-58409965 CTGAAGCAGAATCTCTAGGGAGG + Intronic
1127497329 15:59525262-59525284 CTGAATCAGAGGCTCTGAGACGG + Intergenic
1127592572 15:60440634-60440656 GTGAATCAGACACTCCAGGGTGG + Intronic
1127619107 15:60716092-60716114 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1127634869 15:60859439-60859461 CAGATTCAGTAAGTCTGGGGTGG - Intronic
1127638659 15:60894661-60894683 CAGAATCCGAAAGTCTAGGGAGG - Intronic
1127646972 15:60968376-60968398 CTGATTCAGGAAATCTGGGGTGG + Intronic
1127732931 15:61816952-61816974 CCCAATCAGAATATCTGGGGCGG - Intergenic
1127738346 15:61869824-61869846 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1127856825 15:62960298-62960320 TTAAATCAGAAACTCTGGGTAGG - Intergenic
1127861778 15:62999869-62999891 CTGACTCAGTAAGTCTAGGGTGG + Intergenic
1127896164 15:63301089-63301111 CTGAATCAGAAACAATGGGGTGG - Intronic
1127942523 15:63714021-63714043 CTGATTCAGAAGGTCTGGGGTGG - Intronic
1127942530 15:63714035-63714057 CTGAATCAGAACCTCTAGGTGGG + Intronic
1128299732 15:66558627-66558649 CTGAATCAGAAACTCAAAGCGGG + Intronic
1128393378 15:67198460-67198482 CTGAAGCCGCAACTCTGGAGTGG + Intergenic
1128784960 15:70388161-70388183 TTGCATCTGAATCTCTGGGGTGG - Intergenic
1128788249 15:70414094-70414116 CTGAATCAGGAACACTGGGGTGG + Intergenic
1128804955 15:70523821-70523843 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1129000177 15:72326503-72326525 TTGAATCAGAATTGCTGGGGTGG + Intronic
1129032189 15:72627568-72627590 CTGATTCAGGAGGTCTGGGGTGG - Intergenic
1129033399 15:72634654-72634676 TTGAGTTAGAAACTCTGGTGTGG + Intergenic
1129216486 15:74102576-74102598 TTGAGTTAGAAACTCTGGTGTGG - Intronic
1129217707 15:74109671-74109693 CTGATTCAGGAGGTCTGGGGTGG + Intronic
1129437682 15:75555419-75555441 CTGAATCAGAAACTCCGAGGTGG - Intronic
1129448374 15:75634727-75634749 CTGATTCAGGAGGTCTGGGGCGG - Intergenic
1129471340 15:75756228-75756250 TTGAGTTAGAAACTCTGGTGTGG + Intergenic
1129595475 15:76960710-76960732 CTGAATCAGAATCTCCAGGGAGG - Intergenic
1129734869 15:77953966-77953988 CTGATTCAGGAGGTCTGGGGTGG + Intergenic
1129761831 15:78133361-78133383 CTGATTTAGAAGGTCTGGGGTGG + Intronic
1129834658 15:78694589-78694611 CTGAATCAGAATCTCTGGAGTGG - Intronic
1129840722 15:78742025-78742047 CTGATTCAGGAGGTCTGGGGTGG - Intergenic
1129956261 15:79639533-79639555 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1130025382 15:80266668-80266690 CTGAATCAGAATCTCTGGGAAGG + Intergenic
1130072411 15:80658873-80658895 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1130612940 15:85378094-85378116 CTGATTCAGTAAGTCTGGGGTGG - Intergenic
1130742005 15:86610975-86610997 CTGAATCAGAAACTCAGGAGTGG + Intronic
1130905739 15:88239916-88239938 CGGAATCAGAAACTCTGGGGTGG + Intronic
1130916354 15:88308066-88308088 CTGATTCAGCAAATTTGGGGCGG + Intergenic
1131072618 15:89475609-89475631 CTGAATCAGAACCTCTGGGGTGG + Intronic
1131139502 15:89965581-89965603 CTGTATCAAAAACTCTAGGAAGG + Intergenic
1131156014 15:90076038-90076060 CTGATTCAGTAGATCTGGGGTGG + Intronic
1131292725 15:91120967-91120989 CAGAATCAGAAAGTCTTGAGTGG - Intronic
1131428410 15:92366445-92366467 CTGAATCGGATTCTCTGGAGTGG - Intergenic
1131446483 15:92502212-92502234 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1131481660 15:92787500-92787522 CTGAATCAGAAGCTCTGGAGTGG + Intronic
1131540621 15:93272112-93272134 CACAATTAGAAACTGTGGGGAGG - Intergenic
1131761351 15:95626347-95626369 CTGATTCAGCAGATCTGGGGTGG - Intergenic
1132034620 15:98472137-98472159 CTGAATCAGAAACTCTGCAGTGG - Intronic
1132070904 15:98775769-98775791 CTGAATCGGAAACCCTGGGGTGG - Intronic
1132150332 15:99454254-99454276 CTGGATGGGAAACTCTGGGGTGG - Intergenic
1132157585 15:99507177-99507199 CTGACTGAGAAAGTCTGGGGCGG - Intergenic
1132250679 15:100333436-100333458 GTGAATCGGAATCTCTGGGGTGG + Intronic
1132319219 15:100913192-100913214 CTGAATCAGAAACTCTATGGTGG - Intronic
1132335605 15:101046453-101046475 CTGAATCAGAACCTCGGGTGGGG - Intronic
1133467864 16:6045165-6045187 CTGATTCAGTAAGTCTAGGGTGG + Intronic
1133967730 16:10543809-10543831 CTGACTCAGGAGGTCTGGGGTGG + Intronic
1134332999 16:13267574-13267596 CTGTATTAAAAACTCTGTGGTGG + Intergenic
1134502737 16:14781803-14781825 CTAAATCAGAAACTCTGGGGTGG + Intronic
1134577826 16:15347092-15347114 CTAAATCAGAAACTCTGGGGTGG - Intergenic
1135183593 16:20295807-20295829 CTGAATCAGAAACTCTGGGATGG - Intergenic
1135501708 16:23001422-23001444 CTGAATCAGAATCTCAAGAGTGG - Intergenic
1135569316 16:23536122-23536144 CTGACTCAGTAGGTCTGGGGTGG - Intronic
1135649390 16:24192777-24192799 CTGATTCAGGAGGTCTGGGGTGG - Intronic
1135663657 16:24317753-24317775 CTGATTCAGCAGGTCTGGGGTGG - Intronic
1135873352 16:26172545-26172567 CTGTATCAGAAAGTCTGGCATGG + Intergenic
1135875841 16:26199319-26199341 CTACATGAGAATCTCTGGGGTGG - Intergenic
1136092101 16:27927859-27927881 GTGAATCAGAATCTCTTGGGAGG + Intronic
1137377225 16:47962557-47962579 CTGGATCAGAGACTCTGGGGTGG - Intergenic
1137623025 16:49889133-49889155 CTGAATCAGACTCTCTCTGGGGG - Intergenic
1137797309 16:51232899-51232921 CTAAATCAGAAACTCTAAGGTGG + Intergenic
1137855468 16:51790395-51790417 CTGATTCAGTAGATCTGGGGTGG - Intergenic
1137855474 16:51790409-51790431 CTGAATCAGACCCTCTCGGGTGG + Intergenic
1138195357 16:55047965-55047987 CTGAATCAGAACCTCTTGGGAGG + Intergenic
1138707755 16:58935081-58935103 CAGAATCAGAAACTCCAGGGTGG + Intergenic
1138724000 16:59116201-59116223 CTTGAACAGAAACTCTGGGTGGG - Intergenic
1138958013 16:61994696-61994718 CTGATTCAGTACCTCTGTGGTGG - Intronic
1139026241 16:62821924-62821946 CTGAGTCACAAATTCTGAGGAGG + Intergenic
1139279513 16:65758216-65758238 CTGATTCAGTAAGTCTGGGGTGG - Intergenic
1139370469 16:66465782-66465804 AAGAAACAGAAACTCTGGCGAGG - Intronic
1139393741 16:66623165-66623187 CTGACTCAGTAGCTCTGGAGCGG + Intronic
1139699671 16:68700363-68700385 CTGAATCGGAACCTCTAGGCAGG + Intronic
1140191313 16:72819474-72819496 CTGAATCAGAACCTTAGGGCAGG - Intronic
1140228926 16:73101279-73101301 CTGAATCAGAATTTCTAAGGTGG + Intergenic
1140333283 16:74078697-74078719 AGTAATCAGAAACTCTGGGGTGG - Intergenic
1140525258 16:75617708-75617730 CTGAATCAGAATCTCTGTGGTGG + Intronic
1140564381 16:76024049-76024071 TTGAATCAGTAGATCTGGGGTGG - Intergenic
1140564387 16:76024063-76024085 CTGATTCAAAAACTCCAGGGTGG + Intergenic
1140714555 16:77710339-77710361 ATGAATCAGGAACTCTAGGGTGG + Intergenic
1140761510 16:78113198-78113220 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1140824814 16:78695986-78696008 CTGAATGTGAATCTCTGGTGGGG + Intronic
1141238658 16:82244101-82244123 CTGATTCAGCAATTCTGGGGTGG + Intergenic
1141240900 16:82264281-82264303 CTGAATCAGAAAGGCTGGGTTGG + Intergenic
1141377202 16:83542420-83542442 CTGAATCAGGCAGTGTGGGGAGG - Intronic
1141408922 16:83818991-83819013 CTGAATCAGAGACCCTGGGAGGG + Exonic
1141408973 16:83819221-83819243 CTGATTCAGAATATCTGGGACGG + Exonic
1141491923 16:84379577-84379599 CAGAATCAGAAACTCTGGGCGGG + Intronic
1141554138 16:84826036-84826058 CTGGATCAGAAGCTGTGGGGTGG + Intronic
1141564519 16:84892243-84892265 CTGAATCGGAATCTCTGGGAGGG + Intronic
1141568896 16:84922381-84922403 CTGACTCAGGAGTTCTGGGGTGG + Intergenic
1141701325 16:85643537-85643559 CTCATTCAGAGACTCTGGAGTGG + Intronic
1141994316 16:87627088-87627110 CTGAATCAGTGTCTCTGGGCCGG + Intronic
1142336749 16:89494253-89494275 CTCAATCAGAATCTCTAGAGTGG - Intronic
1142929467 17:3270578-3270600 GGGAATTAGAAACTCTGGGCTGG + Intergenic
1143027964 17:3952039-3952061 CTGAGTCGTAAATTCTGGGGTGG + Intronic
1143047455 17:4093621-4093643 CTGATTCAGGAGCTCTGGGTGGG - Intronic
1143252756 17:5535250-5535272 CTGAATCAGAATCTCTGGGGTGG - Intronic
1143270878 17:5673574-5673596 CGGAATTAGAAGCTCTGGGGTGG - Intergenic
1143374737 17:6460832-6460854 CTCAATCAGAAACTCTGGGGAGG - Intronic
1143444729 17:7000784-7000806 CTGATTCAGTATGTCTGGGGTGG + Intronic
1143596027 17:7914584-7914606 CTGATTCAGGAAGTCTGGAGTGG + Intergenic
1143765412 17:9134539-9134561 ATTAATCAGAGTCTCTGGGGTGG + Intronic
1143782901 17:9238868-9238890 TTCAATCTGAAGCTCTGGGGCGG + Intronic
1143789740 17:9285042-9285064 CTGAATCAGAATCTCCAGGGGGG - Intronic
1143870137 17:9952156-9952178 CTGAATCAGACAGTGGGGGGTGG - Intronic
1143979309 17:10854639-10854661 TTGAATCAGAAACTCTGGGATGG - Intergenic
1144059172 17:11567209-11567231 CTGATTAGGAAAGTCTGGGGTGG - Intergenic
1144099219 17:11929431-11929453 CTGAATCTGAAACTCTGGGCTGG + Intronic
1144099420 17:11930799-11930821 CCCAATCTGAAACTCTGGGCTGG + Intronic
1144166073 17:12611969-12611991 CTGATTCAGAAGGTCCGGGGTGG + Intergenic
1144295158 17:13867909-13867931 TTAAATCAGAATCTCTGGGGTGG - Intergenic
1144302184 17:13931923-13931945 GTGAATCAGACAGCCTGGGGTGG + Intergenic
1144358614 17:14469944-14469966 CTGATTCAGGAGTTCTGGGGTGG - Intergenic
1144366192 17:14547208-14547230 CTGATTCAGTAGCTCTGGGGTGG + Intergenic
1144404374 17:14938658-14938680 TTGAATCAGAATCTCTGGGGTGG + Intergenic
1144458871 17:15441340-15441362 CTGAATCAGAATCTCTAAGGTGG - Intronic
1144520173 17:15947812-15947834 CTGAATCAGAATCTCTGGAGTGG + Intronic
1144590210 17:16517329-16517351 CCAGATCAGAAACTCTGGGGTGG + Intergenic
1144630047 17:16866719-16866741 CTGAGTCAGGAAGTCTAGGGGGG + Intergenic
1144651329 17:17009089-17009111 CTGAATCAGGAGGTCTAGGGGGG - Intergenic
1145402291 17:22551768-22551790 CTGAATCCGAAAAGCGGGGGTGG + Intergenic
1145750650 17:27353383-27353405 CTGAATCAGAATCTCCGGGGTGG + Intergenic
1145774938 17:27521144-27521166 CTGACTTAGTACCTCTGGGGTGG + Intronic
1145832925 17:27931882-27931904 CTCCACCAAAAACTCTGGGGTGG + Intergenic
1146105428 17:30031291-30031313 CTGATTCAGTAAATATGGGGTGG + Intronic
1146297371 17:31660362-31660384 CTGATTCAGTGAATCTGGGGTGG - Intergenic
1146297457 17:31661048-31661070 CTAAGTTAGAAACTCTGGGGTGG - Intergenic
1146466788 17:33092524-33092546 CTGATTCAGTCACTCTGGAGTGG + Intronic
1146595101 17:34161780-34161802 CTGACTCAGCATCTCTGGGGTGG + Intronic
1146909563 17:36639840-36639862 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1147547675 17:41415301-41415323 TTGAATCAGAAACTGTGGTGTGG - Intergenic
1147603400 17:41759643-41759665 CTGAGTCAAAGACCCTGGGGAGG - Intronic
1147711867 17:42472879-42472901 CTGATTCAGTAAGTCTAGGGTGG - Intronic
1147736023 17:42638808-42638830 CTGACTTAGAAGGTCTGGGGTGG + Intergenic
1148117058 17:45182357-45182379 TTAAATCAGAAATTCTGGGCCGG - Intergenic
1148192273 17:45687960-45687982 CTGACTCTGACACTCTGGAGTGG - Intergenic
1148327050 17:46789421-46789443 CAGGATCAGAGCCTCTGGGGAGG + Intronic
1148396804 17:47314699-47314721 CTGATTCAGCAGCTGTGGGGTGG - Intronic
1148459393 17:47829959-47829981 CTGAATCAGCAATTCTGGGGTGG + Intronic
1148861269 17:50605522-50605544 CTGAATCATACACTCTGAGGTGG - Intronic
1149086029 17:52717144-52717166 CTGAATTAGTAGGTCTGGGGTGG + Intergenic
1149146175 17:53496438-53496460 CTGTGTCAGAAACTAGGGGGCGG - Intergenic
1149171726 17:53820149-53820171 CTGAATCAACAACTCTGGCATGG + Intergenic
1149217188 17:54370691-54370713 CTGATTCAGAAAATCTGGTGTGG + Intergenic
1149260936 17:54878713-54878735 CCAAATCAGAAACTCTGGGGTGG + Intergenic
1149262571 17:54896054-54896076 TTAAATCAGAATCTCTGAGGTGG + Intergenic
1149269981 17:54967601-54967623 CTGAGTCAGAAACACGGGGTGGG - Intronic
1149332109 17:55594827-55594849 CTGAATCAGAAACTCAGGTGGGG - Intergenic
1149332117 17:55594841-55594863 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1149400961 17:56295466-56295488 TTGAAGCAGATACTCTGGGATGG + Intronic
1149581556 17:57754162-57754184 CTAATTCAGAAGGTCTGGGGGGG - Intergenic
1149596813 17:57869074-57869096 CTGTCTCAGAAAAGCTGGGGAGG + Intronic
1149635563 17:58166300-58166322 CTGAATGAGAAATTCTGGGCTGG + Intergenic
1149667045 17:58372302-58372324 TTGAATCAAAATCTCTGGGCAGG + Intronic
1149910591 17:60563502-60563524 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1149913054 17:60583810-60583832 CTGATTCAGTAAGTCTGGGATGG - Intronic
1150130924 17:62668540-62668562 CTGATTCAATTACTCTGGGGCGG - Intronic
1150137740 17:62704681-62704703 CTGAAGCGGAATCTCTGGGCGGG + Intronic
1150143787 17:62751403-62751425 CTGATTCAGAAGGTCTGGGTGGG - Intronic
1150602875 17:66665627-66665649 CTGATTCAGGAAGCCTGGGGTGG - Intronic
1150704771 17:67476941-67476963 CTGATTCAGAGGGTCTGGGGTGG - Intronic
1151184060 17:72350664-72350686 ATGAATGAGCAACGCTGGGGAGG + Intergenic
1151379204 17:73713247-73713269 CTGAATCAGAAATTCTTGGCAGG - Intergenic
1151461716 17:74258230-74258252 CTGATTCAGAAAATCTGAGTTGG + Intronic
1151876982 17:76872438-76872460 CTGAATCAGATACTCTGGGGTGG - Intronic
1151964220 17:77422824-77422846 CAGAACCAGAGTCTCTGGGGTGG + Intronic
1151990791 17:77572687-77572709 CTGATTCAGCAAGTCTGGAGTGG - Intergenic
1152307322 17:79528918-79528940 CTGAAGCAGGAACTGAGGGGCGG - Intergenic
1152533813 17:80938604-80938626 CTAAATCAGAAAATGTGCGGAGG + Intronic
1153369640 18:4299145-4299167 CTGAATCCGAAGTTCTGGGGTGG + Intronic
1153481299 18:5549671-5549693 CTGAGTCGGAAGCTCTGGGGTGG + Intronic
1153502972 18:5767711-5767733 CTGATTCAGTAGCTCTGGGCTGG - Intergenic
1153730118 18:8002667-8002689 TTGAATCAGAAACTCTTGAGTGG + Intronic
1154161956 18:11987161-11987183 GTGAATGAGAAACCCTGCGGTGG - Intronic
1154440546 18:14386106-14386128 CTGAATCAGAAGCTCTGGGGTGG - Intergenic
1155139704 18:23033356-23033378 CAAAATCAGAAACTTTGGGGTGG - Intergenic
1155154872 18:23149743-23149765 CTGGGTCAGAAGCTCTGGGGCGG + Intronic
1155280739 18:24237166-24237188 GTTAATCAGAACCTCTGAGGAGG + Intronic
1155349430 18:24891945-24891967 CTGATTCAGTAGATCTGGGGTGG + Intergenic
1155420610 18:25651578-25651600 CTGAGTCAGAGACACTGAGGTGG - Intergenic
1155437332 18:25826897-25826919 CTGGAGCAGAAGCTCTGGTGTGG + Intergenic
1155509093 18:26559450-26559472 CTGATTCAGCCAGTCTGGGGTGG + Intronic
1155911483 18:31508933-31508955 CTGAGTCAGACACTCTAAGGCGG + Intronic
1156496089 18:37525960-37525982 CGGAATCAGAAACTCTGGGGTGG + Intronic
1156560263 18:38116939-38116961 CTGATTCAGAAGGTCGGGGGTGG - Intergenic
1156584001 18:38411432-38411454 CTGAGTCAGAATCTCAGGGGTGG + Intergenic
1156864346 18:41872454-41872476 CTGAATCAGAACCTATGAGATGG - Intergenic
1157203627 18:45680102-45680124 AAGCATCAGAAACTCTGAGGGGG + Intronic
1157215143 18:45776221-45776243 ATGAATCAGAAACACTTGGAGGG - Intergenic
1157389894 18:47293029-47293051 CTGACTCAGAATCTCTCAGGAGG - Intergenic
1157524008 18:48364940-48364962 CTGAATCAGAGATTTTGGAGTGG - Intronic
1157563608 18:48664856-48664878 CGGAATCACAGACTCTGGGGTGG - Intronic
1157618926 18:49004085-49004107 CTGAACCAGAGACTCTGGGTGGG + Intergenic
1157681343 18:49609698-49609720 CTGATTCAGTAAGTCTGGGGTGG + Intergenic
1157725283 18:49959197-49959219 CAGAACCAGAAACACTGTGGAGG - Intronic
1157730448 18:49999802-49999824 CTGAATGAGAAACTCTGGAGTGG + Intronic
1157753308 18:50196502-50196524 CTGAACCATAAACTCTGGTGTGG + Intergenic
1157899343 18:51499127-51499149 CTGATTCAGTAAATCTGAGGTGG + Intergenic
1157899375 18:51499484-51499506 CTGATTCAGTAAATCTGGGGTGG - Intergenic
1157932596 18:51839811-51839833 TCAAATCAGAAACTGTGGGGTGG + Intergenic
1158020278 18:52833533-52833555 CTAAATCTGAGACTCTGGGATGG - Intronic
1158020373 18:52834400-52834422 CTAAATCAGGGACTCTGGGATGG + Intronic
1158110801 18:53939530-53939552 TTGAATCCGAAACTCTAGGGTGG + Intergenic
1158208915 18:55024245-55024267 CTGAATCAGAACCTTTGAAGAGG + Intergenic
1158261053 18:55605985-55606007 CCTGATCAGAAACTCCGGGGTGG + Intronic
1158397262 18:57089025-57089047 CAGAGTCAGCAGCTCTGGGGCGG - Intergenic
1158877261 18:61745243-61745265 ATGAATCAGCAACTCTGAGGGGG - Intergenic
1158982744 18:62780630-62780652 CTGAATCAGAAACTCAGGGTGGG - Intronic
1158985652 18:62813691-62813713 TTGAATGAGAAACTCTTGAGTGG + Intronic
1159011571 18:63063297-63063319 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1159011577 18:63063311-63063333 CTGAATCAGAAACTCTGGAGAGG + Intergenic
1159039947 18:63315134-63315156 CTGACTCAGTAGCTCTGGGGTGG + Intronic
1159058296 18:63488836-63488858 CTGATTCAGTATGTCTGGGGTGG + Intronic
1159488447 18:69097558-69097580 CTGATTCAGTCAGTCTGGGGTGG - Intergenic
1159608734 18:70502500-70502522 CTAAATTAGAATCTGTGGGGTGG - Intergenic
1159945870 18:74444546-74444568 TTGAATCTGAAACGATGGGGTGG - Intronic
1161814293 19:6489958-6489980 CTGAATCTGCAACTGTGAGGGGG + Intergenic
1161990993 19:7684155-7684177 CAGATTCAGCAGCTCTGGGGTGG - Exonic
1162235888 19:9309535-9309557 CTGAATCGGGAACTCTGGTCTGG - Exonic
1163639971 19:18456611-18456633 AGGAATCAGGAACTCTTGGGGGG + Intronic
1163683803 19:18699473-18699495 CTGAACAAGAAGCACTGGGGTGG + Intronic
1164523259 19:28995034-28995056 CTGAATCGGGGACTCTGGGGTGG - Intergenic
1164702440 19:30295460-30295482 CTGAATCTGAAAATGTGGGTTGG - Intronic
1164712528 19:30367624-30367646 TTGATTCAGGAAGTCTGGGGTGG + Intronic
1164750761 19:30653213-30653235 CTGACTCAGTAGTTCTGGGGAGG + Intronic
1164868961 19:31627506-31627528 CTGACTCAGAAACTCTGGGGTGG - Intergenic
1165734247 19:38165703-38165725 TTGAATCAGAAACTCTGGGTGGG - Intronic
1166047938 19:40240574-40240596 CTGAGTCAGAAACTCGGGGTGGG + Intronic
1166186491 19:41142706-41142728 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1166973540 19:46588600-46588622 CTGATTTAGTAAGTCTGGGGTGG + Intronic
1167257220 19:48437991-48438013 CTGAAGCAAAGACTCAGGGGTGG - Intronic
1168083359 19:54026917-54026939 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1168410453 19:56136732-56136754 CTGAATCAGCAACTCTAGCAGGG - Intronic
925579868 2:5399371-5399393 CCGAACCAGAAACCCTGGGACGG + Intergenic
925619379 2:5776189-5776211 CTGAATCAGAATTTTGGGGGTGG - Intergenic
925739354 2:6992266-6992288 TTAAAACAGAAACTCTGGGGAGG - Intronic
925798778 2:7575486-7575508 CTGACCCAGAATCCCTGGGGTGG - Intergenic
926418160 2:12671158-12671180 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
926579545 2:14619626-14619648 CTGAATCAGAATGTCTAGGAGGG - Intergenic
926609218 2:14929148-14929170 CTGATTCAGTAAGTCTGGGATGG - Intergenic
926632077 2:15145800-15145822 CTGGATCAGAAATTCTGGGGTGG + Intergenic
926671164 2:15578146-15578168 CTGAATCAGAAAGTCTAAGGAGG + Intergenic
926996141 2:18737901-18737923 CTGATTCAGCAGATCTGGGGTGG + Intergenic
927198430 2:20563864-20563886 CTGATTCAGCAGGTCTGGGGTGG - Intronic
927285978 2:21357082-21357104 CTGAATCAGCAGGTCTAGGGTGG - Intergenic
927433114 2:23043492-23043514 TAGAATCAGAAGTTCTGGGGCGG - Intergenic
927453880 2:23232671-23232693 CTGAATCAGAAATCGTGGTGGGG + Intergenic
927508896 2:23632046-23632068 CTGAAGCAGAACCTCCAGGGTGG + Intronic
927919332 2:26960141-26960163 CTGAATCAGAAACTTTGGTGTGG - Intergenic
928058852 2:28088659-28088681 TTAAATCAGAATCTCTGGGAGGG + Intronic
928258884 2:29749198-29749220 CTGATTCAGTAGGTCTGGGGTGG + Intronic
928615588 2:33036203-33036225 CCAAATCGGAAACTCTGAGGTGG - Intronic
928720717 2:34117546-34117568 CTGATTCAGAAGGTCTGGGATGG + Intergenic
928726386 2:34178774-34178796 CTGAATCAGTAACTGTGGAGTGG - Intergenic
928726391 2:34178788-34178810 CTGATTCAGTAGATCTGGGGTGG + Intergenic
928726402 2:34178906-34178928 CTGAATCAGAAACTCTGAGGAGG + Intergenic
928902726 2:36338017-36338039 TTATATCAGAATCTCTGGGGTGG - Intergenic
929026355 2:37606991-37607013 CTGACTCAGAAGGTCTAGGGTGG + Intergenic
929146114 2:38708346-38708368 ATGAATCAGAATCTCTGAGGTGG - Intronic
929155337 2:38783925-38783947 CTGAATCAGAATCTGTTGGGAGG - Exonic
929172488 2:38945713-38945735 CTTAGTCTGAAAATCTGGGGAGG + Intronic
929174733 2:38964851-38964873 CTGATTCACAAAGTCTGGGATGG + Intronic
929186166 2:39097424-39097446 CTGAATCAGAAAGTCTTGAGTGG - Intronic
929190985 2:39139378-39139400 CTGAATTAGAAACTCTGGGGTGG + Intergenic
929286463 2:40140548-40140570 CTGAATCAGAAATTGGGGAGGGG + Intronic
929434295 2:41915709-41915731 CTGATTCATTAAGTCTGGGGTGG - Intergenic
929436254 2:41930872-41930894 TTACATCAGAATCTCTGGGGTGG - Intergenic
929784682 2:44980749-44980771 CTGAATCAGAAACTCTGGGGTGG + Intergenic
929784882 2:44982269-44982291 CTGAATCAGAAACTCTGGGGTGG - Intergenic
929851310 2:45592868-45592890 CTCAATCAGAAACTCTGGGGTGG + Intronic
929884353 2:45865111-45865133 CTGAATCAGAAAATCTGGGGTGG + Intronic
929895207 2:45953739-45953761 CTGAATCACAATCTCTTCGGGGG - Intronic
929910255 2:46083711-46083733 CTGGTTCAGAAGATCTGGGGCGG - Intronic
930019247 2:46991215-46991237 CTGAATTAAGAACTCTGGGGTGG - Intronic
930153265 2:48079513-48079535 CTGAATCAGCATCTCTGGGAGGG - Intergenic
930174635 2:48289133-48289155 TTGAATCAGAAACTGGGGGTAGG + Intergenic
930546893 2:52779502-52779524 CTGATTCAGTAGATCTGGGGTGG - Intergenic
930712817 2:54565095-54565117 CTGAATAAGAAATTCTAGGGTGG + Intronic
930754480 2:54960863-54960885 GTGAATCAGAATCTCAGGAGTGG + Intronic
930802193 2:55454362-55454384 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
930846540 2:55911605-55911627 CTGATTCAGTCAGTCTGGGGTGG + Intronic
930854618 2:56000385-56000407 CTGAATCAGAAACTCAGAATGGG - Intergenic
930883805 2:56301480-56301502 CTGTATCAGAATCACTGGAGGGG - Intronic
931230469 2:60370474-60370496 CTGAATCAGAGTCTCTGGGCTGG - Intergenic
931243337 2:60471849-60471871 CTGATTCAGTAAGTCTGAGGTGG - Intronic
931243342 2:60471863-60471885 CTGAATCAGAAATTGAGGGTGGG + Intronic
931684722 2:64783774-64783796 CTGAATCTGGATCTCTGTGGTGG - Intergenic
932001223 2:67886852-67886874 TTAAATCAGAATCTCTGGGTGGG + Intergenic
932132333 2:69199222-69199244 CTGATTCAGAAGTTCTGGGGTGG + Intronic
932281762 2:70498975-70498997 GTAAATTAGAATCTCTGGGGTGG + Intronic
932487915 2:72096228-72096250 CTGAATAAAAAACTCTGGAGTGG - Intergenic
932613614 2:73218022-73218044 CTGATTCAGCAGGTCTGGGGTGG + Intronic
932712453 2:74077283-74077305 CTGGGTCAGAAACTCAGGTGGGG - Intronic
932734434 2:74244740-74244762 CTGAATCGGAAACTCTGGCTGGG - Intronic
932804420 2:74770689-74770711 CTGAATCAGAGAGCCTGGGGTGG + Intergenic
932831992 2:74999040-74999062 CTGAATCAGAAGTGGTGGGGTGG + Intergenic
932838051 2:75055812-75055834 CTGAGTCTGAAACTCTGGGTGGG - Intronic
933200237 2:79439639-79439661 CAGATTCAGTAAGTCTGGGGTGG + Intronic
933230205 2:79798120-79798142 CTGAATGAGACACTCTGGGGTGG + Intronic
933293224 2:80460882-80460904 CTGATTCAGTATATCTGGGGTGG + Intronic
933331259 2:80895768-80895790 CTGAATCAGAGATTCTGTGCTGG - Intergenic
933463431 2:82619482-82619504 GGGAATCAGAAACTCTGGCCTGG - Intergenic
933599322 2:84314114-84314136 CTGAATCAGAAACCCTGGGGTGG - Intergenic
933624390 2:84582409-84582431 CTGAATCAGACACTCTCGGGAGG + Intronic
933640297 2:84751807-84751829 CTGAATCAGAAACTGGGGGATGG - Intronic
933652365 2:84859738-84859760 CTGAACTGGAAACTCTGGGGTGG - Intronic
933788825 2:85867305-85867327 CTGAGTCAGCAAGACTGGGGCGG - Intronic
934085567 2:88506312-88506334 TGGAATCAGCAACTCTGGAGGGG + Intergenic
934122993 2:88857999-88858021 CTGAATTCTAAACTCTGAGGGGG - Intergenic
934779590 2:96961067-96961089 CTAAATCAGACTCTCTGGGCCGG - Intronic
934850670 2:97698708-97698730 TGGAATCAGAAACTCTGGGGTGG + Intergenic
934929426 2:98408744-98408766 CTGACTCAGTAAGTCTAGGGTGG - Intergenic
934934138 2:98452364-98452386 CTGAATCAGAAACTCTGGGATGG + Intronic
935087195 2:99859408-99859430 CTGAGTCAGAATCCCTGGGGTGG + Intronic
935312234 2:101796306-101796328 CTGCATCAGAAACTCAGGACTGG + Intronic
935390085 2:102541834-102541856 CTGAATCAGCAGATGTGGGGTGG + Intergenic
935469256 2:103437255-103437277 TTGACTCAGAAACTCAGGGGTGG - Intergenic
935709959 2:105889515-105889537 CTGTAGCAGAAATTCTGGGGTGG - Intronic
935743638 2:106172667-106172689 CTGAATCAGAATCTCTACAGAGG + Intronic
935746143 2:106192026-106192048 CTGAATCAGAAACTTGAGGTGGG + Intronic
935763315 2:106341755-106341777 CTGCATCAGAAACTCGGGGGTGG - Intergenic
935944401 2:108272080-108272102 CTGGAAAAGACACTCTGGGGAGG + Intergenic
936022342 2:109004429-109004451 CTGAAGCAGACACTCTGGGATGG + Intergenic
936449608 2:112624341-112624363 CTGGATCAGAAACTCTAGGTTGG - Intergenic
936582105 2:113709771-113709793 CTGAATCAGAAACTCTAGGGTGG + Intronic
936594803 2:113837716-113837738 CTGAGTCAGAATCTCTTGAGTGG + Intergenic
936647239 2:114386105-114386127 CTGAATCAGACACTCTGGGCTGG + Intergenic
936974856 2:118208655-118208677 CTGATACAGGAAGTCTGGGGTGG + Intergenic
937024700 2:118688405-118688427 CAGAATCAGAATCCCTGGGTTGG - Intergenic
937311243 2:120904705-120904727 CAGAAGCAGACTCTCTGGGGTGG - Intronic
937437234 2:121890497-121890519 CAGACTCAGAAACTCAGGGTGGG - Intergenic
937632566 2:124119983-124120005 TTAAATCAGATACTCTGAGGTGG - Intronic
937890890 2:126937822-126937844 CTGATTCAGAAGGTCTGTGGCGG - Intergenic
937912945 2:127085046-127085068 GTGAAGCAGCAGCTCTGGGGTGG - Intronic
938050714 2:128168169-128168191 CTGATTCAGTAAGTCTGGGTTGG + Intronic
938403917 2:131016704-131016726 CTGAATCAGAAACTCTGGGGTGG - Intronic
938407868 2:131042634-131042656 GTGAATCAGAAGCCCTGGGGCGG + Intronic
938668596 2:133565278-133565300 ATGATTCAGTAAGTCTGGGGTGG + Intronic
938733766 2:134167460-134167482 CTCAATCGGAAACTCTGGGATGG - Intronic
938771866 2:134507472-134507494 CTGATTCAGTAGGTCTGGGGTGG - Intronic
938774014 2:134525276-134525298 CCTGATCAGAGACTCTGGGGTGG + Intronic
939045464 2:137244981-137245003 CTGATTCAATAACTATGGGGGGG + Intronic
939067795 2:137505310-137505332 CTGATTCAGTGGCTCTGGGGAGG + Intronic
939102999 2:137916826-137916848 CTGAAACAGAGGCTCTGGGGTGG + Intergenic
939253106 2:139708688-139708710 CTGAATCAGAAACTCTGTGGTGG - Intergenic
939332574 2:140783949-140783971 CTGGATCATACAGTCTGGGGTGG - Intronic
939604846 2:144241202-144241224 GTGAACCAGAAACTCTGGAGTGG + Intronic
939657913 2:144850748-144850770 CTGATTCAGTAAGTCTGGGGTGG + Intergenic
939816063 2:146898733-146898755 TTGACTCAGAAACTCAGGGTGGG - Intergenic
939960622 2:148562006-148562028 CTGATTCAGAAAGTCTGGGCAGG + Intergenic
940285915 2:152033015-152033037 CTGAAGCAGAACCTCTGCAGGGG - Intronic
940305999 2:152227560-152227582 CTGATTCAGTAGCTCTGGCGTGG - Intergenic
940328047 2:152445658-152445680 CTGAATCAGAAACTTTGGGGAGG - Intronic
940349629 2:152667783-152667805 TTGAATTAGTAAGTCTGGGGTGG - Intronic
941498024 2:166231497-166231519 CTGAGTCAGAAACTCCAGGATGG - Intronic
941752048 2:169144045-169144067 CTGATTCAGAAGGTCTGGGGTGG + Intronic
941860273 2:170272219-170272241 CTGAATCAGAAACTGGGAGTGGG + Intronic
941956944 2:171214589-171214611 CTGAATCAGAAATTGTAGGGTGG - Intronic
942106930 2:172642524-172642546 CTGAATCACAAACTCAGCGTGGG + Intergenic
942393966 2:175526730-175526752 CTGATTTAGAAACTTTGGGATGG - Intergenic
942393972 2:175526744-175526766 CTAAATCAGAAGGTCTGGGTAGG + Intergenic
942552119 2:177130472-177130494 CAGAATCAGAATCTCTAGGGAGG - Intergenic
942764213 2:179434636-179434658 CTGAATAATAATCTCTAGGGTGG + Intergenic
942848377 2:180453786-180453808 TTGAATCAGAAGCTCTGGGGTGG + Intergenic
942898001 2:181081103-181081125 CTGAATTAGAATCTCTGAGATGG - Intergenic
943332559 2:186577114-186577136 CTAAATCAGGATTTCTGGGGTGG - Intergenic
943394649 2:187318809-187318831 CTGAATGAGTAACTATGGGGTGG + Intergenic
943580227 2:189675125-189675147 TTGAATCAGAAACTCAGTGGTGG + Intronic
943754640 2:191545299-191545321 GTGAATCAGAAACTCTTAGGTGG + Intergenic
943759304 2:191591243-191591265 CTGCGTCAGAAACCCTGGGGTGG + Intergenic
944432293 2:199646418-199646440 CTGCATAGAAAACTCTGGGGTGG - Intergenic
944533553 2:200687674-200687696 CTGAATCAGAACCCCTGGTCAGG - Intergenic
944800996 2:203238182-203238204 CTGAATCAAACACTCGGGGTGGG - Intergenic
944860124 2:203807961-203807983 CTAAATCAGACACTTTGAGGGGG + Intergenic
945169106 2:206977567-206977589 CTGAATCAGAAACTCTGATGGGG - Intergenic
945260627 2:207839982-207840004 GTGAATCATAAACTCTGGGCTGG + Intronic
945442329 2:209894591-209894613 CTGATTCAGCAGATCTGGGGTGG + Intronic
945622280 2:212155490-212155512 CTGACTCAGAAGGTCTGGGGCGG - Intronic
945684908 2:212957598-212957620 CTTATTCATAAACTTTGGGGTGG - Intergenic
945806574 2:214497741-214497763 ATGAATCAGAATCTCTGGGAGGG + Intronic
946015565 2:216601438-216601460 ATCAAGCAGAAACTCTGGGTGGG + Intergenic
946094561 2:217262007-217262029 CTGAATCAGAATCACTTGTGAGG + Intergenic
946548833 2:220777747-220777769 CCGATTCAGTAAGTCTGGGGTGG + Intergenic
946876256 2:224132757-224132779 CTGAATCTTAAAGTCTGAGGAGG + Intergenic
946990293 2:225321663-225321685 CTGATTCAGCAAGTCTGGAGAGG + Intergenic
947046514 2:225993205-225993227 CTGAGTCAAAAACTCTGGAGTGG + Intergenic
947137286 2:226987843-226987865 CTGCATCAGAATCTGTGGTGAGG + Intronic
947228781 2:227864892-227864914 ATGAACCAGAGACCCTGGGGTGG - Intergenic
947534832 2:230933974-230933996 CTGACCCAGCACCTCTGGGGTGG - Intronic
947834945 2:233168757-233168779 CTGAATCTGAAATCCTGGGATGG - Intronic
947908103 2:233780368-233780390 CTGATTCAGTAAGTCTGGGGTGG + Intronic
947981773 2:234416608-234416630 CTGAGACAGCCACTCTGGGGTGG + Intergenic
948029827 2:234808311-234808333 CTGAATGAGAACCTCTTGGGTGG - Intergenic
948308476 2:236967914-236967936 CTGATTCAGAGGGTCTGGGGTGG - Intergenic
948308483 2:236967928-236967950 CTGAATCAGAAACTCTAAGGCGG + Intergenic
948677770 2:239609161-239609183 CTGAGTCAGAAACTCTGGGTTGG + Intergenic
1168912477 20:1460334-1460356 CTGAATCAGAGCCTCTGGAAGGG + Intronic
1169004343 20:2194249-2194271 CTGATTCAGCGAGTCTGGGGCGG + Intergenic
1169093937 20:2879315-2879337 CTGAATCAGTAGGTTTGGGGTGG + Intronic
1169117639 20:3076209-3076231 CTGTATCAGAGCCACTGGGGTGG - Intergenic
1169265213 20:4163230-4163252 CTAAATTAGACTCTCTGGGGTGG - Intronic
1169304804 20:4480183-4480205 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1169343391 20:4812609-4812631 CTGATTCAGTAATTCTGGGGTGG + Intronic
1169388632 20:5171660-5171682 GTGTTTCAGAAACTCTGGAGTGG + Intronic
1169390067 20:5183284-5183306 ATGAATCAAAAAGTCAGGGGTGG - Intronic
1169528406 20:6455640-6455662 CAGAATCAGAAATTCTGAAGGGG + Intergenic
1169569577 20:6891403-6891425 ATGAATTGGAAACTCTGGGATGG - Intergenic
1169620799 20:7504397-7504419 TTGAATCAGATTCTCTGGGGTGG - Intergenic
1169693610 20:8361484-8361506 CTAAATTAGAAACTCTGGGGTGG - Intronic
1169727276 20:8749186-8749208 CTGATTCAGTAGGTCTGGGGCGG + Intronic
1169739137 20:8871005-8871027 CTGATTCAGAAGATCTGGGGTGG - Intronic
1169799967 20:9504854-9504876 CAGAATCAGCATCTCTGGGTGGG + Intergenic
1169814018 20:9638059-9638081 CTGAATCAGAATACCTAGGGTGG + Intronic
1169858316 20:10126797-10126819 CTGATTCAGTAAGTCTGGGGAGG - Intergenic
1169878806 20:10325182-10325204 CTGAGTGAGAATCTCTGAGGTGG + Intergenic
1169888635 20:10429884-10429906 CTGAGTCAGAAACTCTAGGGTGG + Intronic
1169910508 20:10644219-10644241 CTGAGTCAGGAGGTCTGGGGTGG - Intronic
1169916607 20:10689797-10689819 TTGATTCAGAAAGTCTGGGGTGG + Intergenic
1169995922 20:11556507-11556529 CTGAATCAAAAGCTCTTGGGTGG - Intergenic
1170044413 20:12070575-12070597 CTGAGTCAGAATCTCTGCAGGGG - Intergenic
1170157504 20:13282014-13282036 CTGAGTCAGAAACTCTGGAGTGG + Intronic
1170282731 20:14669211-14669233 CTGTATCTGTAACTCTGGAGAGG - Intronic
1170284573 20:14692163-14692185 CTGAATCAGTAGGTGTGGGGTGG - Intronic
1170383749 20:15793272-15793294 CTGAATCAGAGTCTCTACGGTGG - Intronic
1170408241 20:16062204-16062226 CTGAATGAGAAACTCTAGGTTGG - Intergenic
1170437111 20:16341704-16341726 CTTCATCAGAAACTCTGGGCTGG + Intronic
1170464940 20:16613938-16613960 CTGATTCAGAAGATCTGGGATGG - Intergenic
1170471737 20:16674679-16674701 TTAAATCAGAATCTCTAGGGTGG - Intergenic
1170493038 20:16897957-16897979 CTGAATCAGGAACTCTTTGTAGG + Intergenic
1170531305 20:17295335-17295357 CTGAATCAGACTGTCTGGGTTGG - Intronic
1170554611 20:17505317-17505339 CTGACCCAGGAGCTCTGGGGCGG - Intronic
1170633176 20:18082579-18082601 CTGACTCAGTGAGTCTGGGGTGG - Intergenic
1170713278 20:18810754-18810776 CTGAATCAAAAACTCTGGGGAGG - Intronic
1170737744 20:19026058-19026080 CTAAATCAGGAACTCGGGGCTGG + Intergenic
1170987898 20:21274950-21274972 CTGGATTGGAATCTCTGGGGTGG - Intergenic
1171160989 20:22923310-22923332 CTGAGGCAGAAACTCCAGGGTGG - Intergenic
1171390363 20:24797900-24797922 CTGATTCAGTGAGTCTGGGGTGG - Intergenic
1171403479 20:24893854-24893876 CTGAATCAGAGTCTCTGTGTGGG + Intergenic
1171427028 20:25055604-25055626 TGGAATCAGAAACCCTGGGATGG - Intronic
1171852799 20:30320351-30320373 CTGACTCAGTAGATCTGGGGTGG + Intergenic
1171964565 20:31519607-31519629 CTGAATCAGAAGCTCAAGGTGGG + Intronic
1172052158 20:32126283-32126305 CTGATTCAGAAGGTCTGGGTAGG - Intronic
1172079020 20:32324293-32324315 TTAAATCAGAATCTCTGAGGTGG - Intronic
1172248522 20:33462793-33462815 CTGAATCAGTAACTCTGGGGTGG - Intergenic
1172428751 20:34873532-34873554 CTGAATCATGATCTCTGGAGTGG - Intronic
1172456376 20:35077492-35077514 CTGAATCAGAATTTCAGGGGTGG + Intronic
1172488081 20:35311615-35311637 CTGACTCAGCAAGTCTGGGGCGG - Intronic
1172519938 20:35559897-35559919 TTGAATCAGAGACTCTGGGTGGG + Intergenic
1172606391 20:36217009-36217031 TTGACTCGGAAACTCTAGGGTGG + Intronic
1172699605 20:36845166-36845188 CTGATTCAGCAAGTCTGGGTTGG - Intronic
1172850360 20:37958021-37958043 CTGAATCAGAAACTCTGCAGTGG - Intergenic
1172911669 20:38414032-38414054 CTGAATCAGAAACTCAGGGGAGG + Intergenic
1173040903 20:39461338-39461360 CTGATTCAGAAAGTCTGGGATGG - Intergenic
1173066643 20:39719480-39719502 CTGAGTCAGGAAATCTAGGGTGG - Intergenic
1173125066 20:40328951-40328973 CTGATTCAGAAAATCATGGGTGG - Intergenic
1173331775 20:42081245-42081267 CTGATTCAGTAAATCTGGAGTGG + Intronic
1173338743 20:42135441-42135463 CTGAATCAGAAACTGTGGGGTGG + Intronic
1173339119 20:42138104-42138126 CTGATTCAGTAAGTCTGGGGTGG + Intronic
1173370504 20:42430402-42430424 CTGACTCAGAAGACCTGGGGTGG + Intronic
1173451831 20:43171699-43171721 CTGAATAAAAAACTCTGGCGTGG - Intronic
1173476236 20:43361781-43361803 CTGAATCAGAAACTTGGGGTGGG - Intergenic
1173551042 20:43933433-43933455 CTGATTCAGTAGGTCTGGGGCGG + Intronic
1173818064 20:46002792-46002814 TTGAATCAGCAACTCCGGGGTGG - Intergenic
1173853750 20:46236213-46236235 GTGAGCCAGAAACGCTGGGGGGG + Intronic
1173897823 20:46564002-46564024 CTGATTCAGCAAGTCTGGGGTGG + Intronic
1174133085 20:48359668-48359690 CTGAATCAGAACCTCAGGGTGGG - Intergenic
1174475184 20:50791190-50791212 CTGATTCAGAACGTCTGGGGTGG + Intergenic
1174507506 20:51026033-51026055 CTGAATCAGCCACTCCAGGGTGG - Intergenic
1174572956 20:51515891-51515913 GTGCATCAGAACCTCTAGGGTGG - Intronic
1174658734 20:52192370-52192392 CTGAAGCAGAAACGCTAGGGTGG - Intronic
1174732837 20:52934950-52934972 CTGACTCAGTAGGTCTGGGGTGG + Intergenic
1174741786 20:53021319-53021341 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1174888465 20:54362619-54362641 CTGAGTCTGGAACTCTGGTGGGG - Intergenic
1174891855 20:54403731-54403753 CTGATTCAGTAGGTCTGGGGAGG - Intergenic
1174975256 20:55325695-55325717 CTGCTTCAGAAACTGTGGGATGG + Intergenic
1175165441 20:57040478-57040500 CTGATTCTGAAGGTCTGGGGTGG - Intergenic
1175597847 20:60249676-60249698 CTGATTCAGGACCTCTGGGGTGG - Intergenic
1175597855 20:60249690-60249712 CTGAATCAGCAAGTCTGGGGAGG + Intergenic
1175615369 20:60393794-60393816 CTGAATCAGAAACTCTGGGGTGG - Intergenic
1175692040 20:61072564-61072586 CTGACTCAGAAGCTCTGGTTGGG + Intergenic
1176455497 21:6905061-6905083 CTGAATCAGAAGCTCTGGGGTGG + Intergenic
1176833669 21:13770109-13770131 CTGAATCAGAAGCTCTGGGGTGG + Intergenic
1177226132 21:18258983-18259005 CTGAATCTGAAACCCAGAGGAGG + Intronic
1177438742 21:21090123-21090145 CTGATTCAGTGATTCTGGGGTGG - Intronic
1177650091 21:23949125-23949147 CTGATTCAAAAACTCTGAGGTGG + Intergenic
1178083976 21:29094397-29094419 CTGATTCAGAAAGTCTAGGGTGG + Intronic
1178156785 21:29863260-29863282 CTGATTCAGTAAGTCAGGGGTGG + Intronic
1178267296 21:31155354-31155376 TTTCATCAGAATCTCTGGGGTGG + Intronic
1178814603 21:35916954-35916976 TTAAATCAGAGACTCTAGGGAGG + Intronic
1178964651 21:37104822-37104844 TTGAATCAGAATCTCTGGGGTGG - Intronic
1179119185 21:38527354-38527376 TGGAATCAGAATCTCTGAGGTGG + Intronic
1179174853 21:39000944-39000966 CTGAATCAGAAATGCTGGGGAGG - Intergenic
1179185898 21:39085103-39085125 CTGACTCAGGAGGTCTGGGGTGG - Intergenic
1179305876 21:40153684-40153706 CTGATTCAGGAACTCTGAGTGGG - Intronic
1179321971 21:40300806-40300828 CTGACTCAGTACATCTGGGGTGG + Intronic
1179354277 21:40644051-40644073 CTGAATTAGAATGTCTGGGCTGG - Intronic
1179363966 21:40738665-40738687 CTGAATCAGATTCTCTGGGGTGG - Intronic
1179636724 21:42716382-42716404 CTGAAACACAAAAGCTGGGGAGG - Intronic
1179647014 21:42782251-42782273 CAGAATCAGAATCTCAGGGCTGG - Intergenic
1180597879 22:16990842-16990864 CTGATTCAGTAAGTCTGGAGTGG + Intronic
1180632646 22:17240423-17240445 CCGACTCAGAAACTCCAGGGCGG + Intergenic
1180738090 22:18033725-18033747 CTGAATCAGAAAGTCCTTGGGGG - Intergenic
1181043448 22:20203695-20203717 CTGCACCAGAAACACTGGGCTGG - Intergenic
1181867537 22:25870741-25870763 GTAAATCAGAAACTCTGGAGGGG + Intronic
1181868145 22:25875616-25875638 CTGATTCAGCCACTCTGGGATGG - Intronic
1182013681 22:27021435-27021457 CTGAATCAGAATCTTTAGGTTGG + Intergenic
1182085387 22:27557661-27557683 CTGCAATAGAAACTCTGGGATGG - Intergenic
1182322544 22:29487678-29487700 CTGATTCAGCAGGTCTGGGGAGG - Intronic
1182818553 22:33191381-33191403 CTGAATCAGAATCTCTGGAGCGG + Intronic
1183038420 22:35157983-35158005 CTGATTCAGTAAGTCTGGGGTGG - Intergenic
1183416482 22:37685485-37685507 TCGGATCAGAAACTCCGGGGTGG + Intronic
1183727912 22:39599678-39599700 CTGAAGCAGAATTTCTGGGTGGG + Intronic
1184722566 22:46323561-46323583 CCAAATCAGAACCCCTGGGGTGG - Intronic
1185049745 22:48547763-48547785 CGGAGTCCGAGACTCTGGGGTGG + Intronic
949194626 3:1290072-1290094 GTGATTCAGTAAGTCTGGGGAGG - Intronic
949334958 3:2964549-2964571 CTGATTCAGAAAGTTTGGGATGG + Intronic
949351737 3:3130265-3130287 CTGAATTAGAATCTCTGGGTGGG + Intronic
949358181 3:3203608-3203630 CAGAATGGGAAACTCTAGGGAGG - Intergenic
949367664 3:3300707-3300729 CCGAATCAGAGACTCTGGCATGG - Intergenic
949564837 3:5235066-5235088 CAGAATCAGCAGATCTGGGGTGG + Intergenic
949572421 3:5306409-5306431 CTGATTCAGTAGATCTGGGGTGG - Intergenic
949737080 3:7185714-7185736 CTAACTCAGAAACTCTGGGAAGG + Intronic
949745078 3:7281758-7281780 CTGATTCAGTAGGTCTGGGGTGG - Intronic
949867547 3:8558921-8558943 CTGTATCAGACACTGTGGGGAGG + Intronic
949894476 3:8759043-8759065 CTGACTCAGTAGGTCTGGGGTGG - Intronic
949936273 3:9118696-9118718 CTGGATCAGAACTTCTTGGGGGG - Intronic
949951496 3:9232741-9232763 CTGAATCAGAATCTCTGTTGGGG - Intronic
949951503 3:9232755-9232777 CTGATTCAGTAGGTCTGGGGTGG + Intronic
950035704 3:9883799-9883821 CTAAGTGAGAAATTCTGGGGTGG - Intergenic
950236683 3:11327850-11327872 CTGATTCAGCAGGTCTGGGGAGG + Intronic
950393505 3:12715663-12715685 CTGAATCAGAAATTCCAGGGTGG + Intergenic
950406151 3:12806380-12806402 CTGAATCTGAATCCCTGGGCAGG - Intronic
950425022 3:12920565-12920587 CTGCATCTGCAACCCTGGGGTGG - Exonic
950519912 3:13491934-13491956 ATGGATCAGAAACTCTGGGAGGG - Intronic
950648798 3:14394328-14394350 CTGAATCAGAAACTCTGTGGTGG - Intergenic
950652091 3:14413570-14413592 CTAAATGAGAAGGTCTGGGGTGG - Intronic
950738875 3:15033786-15033808 CGGACTGAGAAACTCTGTGGAGG - Intronic
950964299 3:17135680-17135702 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
951063408 3:18236645-18236667 CTGAATCAGGAAGTCTGGAGTGG + Intronic
951203091 3:19896272-19896294 CTGAGTCAGGAACTCTGGGGTGG - Intronic
951355308 3:21659882-21659904 CTGAATCAAAAGTTCTGGGGAGG - Intronic
951403891 3:22270029-22270051 CTGGCTCAGACTCTCTGGGGTGG + Intronic
951418432 3:22453650-22453672 CTGAATAATAAACTCTGAAGTGG - Intergenic
951428775 3:22582014-22582036 ATGAATCAAAAACTCTGAAGTGG - Intergenic
951574716 3:24101874-24101896 CTGAATCAGAAACTGGGGTGGGG - Intergenic
951612945 3:24511818-24511840 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
951624229 3:24642577-24642599 CTGACTCAGTAGGTCTGGGGAGG + Intergenic
951680195 3:25286490-25286512 CTGAAGAAGAAAGTCTGGAGAGG - Intronic
951768521 3:26228136-26228158 CTGAATTAGAATCTCTGGGTTGG - Intergenic
951981411 3:28571120-28571142 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
952198105 3:31097210-31097232 CTGAATTAGAAACTCTGGGAGGG - Intergenic
952327939 3:32337683-32337705 CTGAATCAGCATTTCTGGGAAGG - Intronic
952330553 3:32360824-32360846 CTGAATCAGAAATTCTGTAGAGG + Intronic
952410700 3:33047409-33047431 CTGAATTAGAATCTCTGGGATGG - Intronic
952418808 3:33113651-33113673 CTGATTCAGAAAGTCTGGGGTGG - Intergenic
952467470 3:33605202-33605224 CTGATTCAGTAATTTTGGGGTGG - Intronic
952568972 3:34690995-34691017 CTGAATCAGTAGCTCTGGAGTGG + Intergenic
952742350 3:36746862-36746884 CTGATTCAGACAGTCTGGGTGGG + Intergenic
952831837 3:37571589-37571611 CTGAATCAGAAACGCTGGGGTGG - Intronic
952991215 3:38832609-38832631 CTTACTCAGTCACTCTGGGGTGG - Intergenic
953041821 3:39262260-39262282 CAGAATCACAGACTCTTGGGTGG - Intergenic
953129719 3:40126240-40126262 CTGAATCAGAAACTCTGGGGTGG + Intronic
953182087 3:40605317-40605339 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
953204873 3:40817251-40817273 CTGATTCAGTATGTCTGGGGTGG - Intergenic
953596016 3:44314795-44314817 CTGATTCATTAAGTCTGGGGTGG + Intronic
953659872 3:44884090-44884112 CTGAATCAGAAACTCAGGGTGGG + Intronic
953735343 3:45489445-45489467 CTAAATCAGTATCCCTGGGGTGG - Intronic
953749346 3:45597257-45597279 CTGAATCAGAAACTGTGGGATGG + Intronic
953780816 3:45868951-45868973 CTGAGTCAGTAGGTCTGGGGTGG - Intronic
953827534 3:46267003-46267025 CTGAATCAGGAACTCTTGGGTGG - Intergenic
953843806 3:46410842-46410864 CTGAACCACAAACTCCGGGATGG - Intronic
954011762 3:47646307-47646329 CTGAATCATAAACACTTAGGAGG + Intronic
954344079 3:49981376-49981398 CTGAATCAGAAACTCTGGGGTGG + Intronic
954531865 3:51328076-51328098 TTGGATCAGAAACTCAGGGTGGG - Intronic
955480269 3:59382811-59382833 CTGAATCTAAAACTCAGGAGTGG + Intergenic
955518855 3:59754953-59754975 TTAAATCAGAATCCCTGGGGTGG - Intronic
955529006 3:59852873-59852895 CTGAATCAGAAACCCTTGTTGGG + Intronic
955595753 3:60588580-60588602 CTGATTCAGAACCTCTGGGGTGG + Intronic
955639597 3:61068030-61068052 CTTAATCAGAAACTCTGAGGAGG - Intronic
955661842 3:61307733-61307755 ATGAATGAGAAACTCTGGGGTGG + Intergenic
955776769 3:62441974-62441996 CTGATTCAGTCATTCTGGGGTGG - Intronic
955783167 3:62507673-62507695 CTGATTCAGCAGGTCTGGGGTGG - Intronic
955788611 3:62565516-62565538 CTGATACAGTAAGTCTGGGGTGG - Intronic
955813574 3:62818287-62818309 CTGTATCAAAATCTCAGGGGAGG + Intronic
955824954 3:62936016-62936038 CAGAAGCAGAAACTCTCAGGAGG - Intergenic
955837066 3:63067723-63067745 CTGAGTCAGTAGGTCTGGGGCGG - Intergenic
955879738 3:63530662-63530684 CTCATTCAGAAGCTCTGCGGTGG + Intronic
956051130 3:65249641-65249663 CTGGTTCAGAATCTCTGTGGTGG + Intergenic
956274188 3:67480386-67480408 CTGACTCTGAAGGTCTGGGGTGG + Intronic
956291181 3:67661986-67662008 CTGAATCAGAACTTCTGGAGAGG - Intergenic
956304883 3:67812791-67812813 CTGAATTAGAAACTCTAGAAGGG - Intergenic
956397095 3:68837563-68837585 TTGAATCAGAATCACTGGAGTGG - Intronic
956567444 3:70654879-70654901 GTGAATCAGAATCTCTGAGATGG + Intergenic
956647186 3:71467791-71467813 CTGAATCAGAAACTCAAAGAGGG - Intronic
956663049 3:71618003-71618025 CTGAATCAGAATCTCTGGAGGGG + Intergenic
956865712 3:73366794-73366816 CTGATTCAGACCCTCAGGGGAGG - Intergenic
956871901 3:73426758-73426780 CTGAATCAGAAACGCTGGGGTGG - Intronic
956871908 3:73426772-73426794 CTGATTCAGTAGCTCTGGGGCGG + Intronic
956891669 3:73620151-73620173 CTGATTCAGAAACTCTGGTTTGG + Intronic
957028555 3:75213936-75213958 CTGAGTCATACACTGTGGGGAGG + Intergenic
957202657 3:77157000-77157022 CTTAATCAGAAACTCTGGGATGG + Intronic
957332725 3:78787073-78787095 CTGAATCAAAAACTTGGGGTTGG - Intronic
957337992 3:78857627-78857649 CTGAGTCAGCAGGTCTGGGGTGG - Intronic
957502636 3:81077057-81077079 CTGAATCAGAAACCCTAGGATGG - Intergenic
957530690 3:81437692-81437714 CTGATTTAGTAAATCTGGGGTGG + Intergenic
957938756 3:86977627-86977649 CAGAATCAGAAGCTCTGGGGTGG - Intronic
957996453 3:87696118-87696140 CAGAATCAGAAGCTCTGGGGTGG - Intergenic
958070982 3:88610973-88610995 TTGAATCAGAAACTCTGGGGTGG + Intergenic
958434714 3:94082335-94082357 CTGAATCAGAAACTCTGGCTAGG + Intronic
958745616 3:98130016-98130038 CTGTTTCAGTAATTCTGGGGTGG - Intergenic
958797397 3:98720226-98720248 CAGAATCAGAAACCCTAGGCAGG + Intergenic
958917428 3:100065183-100065205 CAGATTCAGTAAGTCTGGGGTGG - Intronic
958970369 3:100604261-100604283 ATGAATCTGAAATCCTGGGGTGG - Intergenic
959087178 3:101863883-101863905 CTGATTCAGGAAACCTGGGGTGG - Intergenic
959126936 3:102301054-102301076 CTGAAACAGAAACTGAGGGTGGG + Intronic
959209566 3:103360141-103360163 CTAAATCAGAAACTCTGGGTTGG + Intergenic
959392348 3:105792104-105792126 CTGAGTCAGCAATTCTGGGGTGG - Intronic
959523128 3:107343264-107343286 CTGAATCAGAATCTCTTTGTTGG - Intergenic
959533705 3:107462127-107462149 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
959535719 3:107482871-107482893 TTAAATTAGAACCTCTGGGGTGG - Intergenic
959835965 3:110918295-110918317 TTGAGTCAGAAACTCTGTGCTGG - Intergenic
959871066 3:111329156-111329178 GTGAATCAGAATCACTGGGAGGG + Intronic
959871069 3:111329205-111329227 CTTAATCAGAAGTTCTGGGGTGG - Intronic
959901685 3:111668941-111668963 CTGCATCAGATCCTCTGGGATGG - Intergenic
960165292 3:114394606-114394628 CTGATTCAGCATGTCTGGGGTGG + Intronic
960171100 3:114461775-114461797 CTGAATCAGATGCTCAGAGGTGG + Intronic
960192706 3:114726504-114726526 CTGAATAAGAAACTTTGAGGTGG - Intronic
960194091 3:114743669-114743691 CTGAATCAGAAACTTGGTGAAGG + Intronic
960639419 3:119811975-119811997 CTGAATCTGAAGCTCCAGGGAGG + Intronic
960855832 3:122101253-122101275 CTGAATCAGTAAGTCTTGGGTGG + Intronic
960947614 3:122977788-122977810 GTGCATCAGAATCTCTGGGGTGG - Intronic
961133465 3:124489789-124489811 CTAAATCAGAATATCTGGGGAGG + Intronic
961208984 3:125110612-125110634 CTGAACCAGGAACTCTGAGGAGG - Intronic
961217605 3:125172540-125172562 CTGGATCAGAGTCTCTGGTGAGG - Intronic
961496681 3:127298017-127298039 CTTCATCAGAATCTCTGGGGTGG - Intergenic
962027225 3:131560833-131560855 TTAAATCAGAGATTCTGGGGTGG + Intronic
962100763 3:132339830-132339852 CTACTTCAGAACCTCTGGGGAGG - Intronic
962115330 3:132499922-132499944 CTGAATCAGAAACTTGGGGTGGG - Intronic
962115338 3:132499936-132499958 CTGATTCAGTGAGTCTGGGGTGG + Intronic
962164780 3:133037996-133038018 CTGATCCAGAAGGTCTGGGGTGG - Intergenic
962265032 3:133938731-133938753 CCGACTCAGTAAGTCTGGGGTGG - Intronic
962286000 3:134085919-134085941 TTGAATCAGAAGCAGTGGGGTGG + Intronic
962419518 3:135215765-135215787 ATGAATCAGAAACTCTTGGGTGG - Intronic
962452678 3:135533659-135533681 CTGAATCAGAAATGCTGGAGTGG - Intergenic
962490947 3:135893693-135893715 CTGTATCAGAAACTCTGGGGTGG + Intergenic
962569448 3:136697553-136697575 TTGATTCAGAAAATCTTGGGAGG + Intronic
962685310 3:137842085-137842107 CTGATTCAGGAAGTCTGGGATGG + Intergenic
962748937 3:138418504-138418526 CTGAATCCAAAACCCTGGGTTGG + Intergenic
962806407 3:138930490-138930512 CTGAATCAGCAACTCTAGGGTGG - Intergenic
962898813 3:139739001-139739023 CTGAATTAGAAATGCTGGGGTGG - Intergenic
962932615 3:140051884-140051906 CTGCATCAGCAACTGTGGGGTGG - Intronic
962958164 3:140285631-140285653 ATGAATTAGAAACCCTAGGGAGG - Intronic
963323905 3:143840121-143840143 GGGAATCAGAAACTCTGGGGTGG - Intronic
963512376 3:146263791-146263813 GTGTAAAAGAAACTCTGGGGTGG + Intergenic
963783530 3:149510466-149510488 CTGAATCAGCAACTCTGGGGTGG - Intergenic
963868375 3:150386799-150386821 CTGTATCAGGAACCCTGGGAAGG + Intergenic
963874134 3:150454567-150454589 CTGAATCAGAAACTCTGAGTGGG + Intronic
964066850 3:152590475-152590497 ATGATTCAGAAACTTTTGGGGGG - Intergenic
964232344 3:154486009-154486031 CTGAATCCCAAAATCTGGGTTGG + Intergenic
964408259 3:156372463-156372485 TTGAATCAGAATCTCCAGGGTGG - Intronic
964663526 3:159148009-159148031 CTGATTCAGCAGTTCTGGGGTGG - Intronic
964780322 3:160330052-160330074 TTGAATCTGAATCTCTGGAGAGG + Intronic
965370284 3:167853459-167853481 TTGAATCAGAAAATCTGTGGAGG - Intergenic
965491273 3:169339325-169339347 TTGAATCAGAAACTCGGGGATGG + Intronic
965521261 3:169669663-169669685 CTGATTCAGTAAGCCTGGGGTGG + Intergenic
965658931 3:171020366-171020388 CTGGATTAGAATCTCTGGGGTGG + Intronic
965684198 3:171284100-171284122 ATGAATCTGAAACTCTGGAGGGG + Intronic
965698082 3:171429995-171430017 CTGAATCAGTAGGTCTGGGATGG - Intronic
965787877 3:172355500-172355522 CTTAATTAGAAAATCTAGGGGGG + Intronic
965814076 3:172618943-172618965 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
965946819 3:174252784-174252806 CTGAATCAGAGTTTCTGGAGAGG - Intronic
966037805 3:175441530-175441552 CTGATTCAGAAGACCTGGGGTGG + Intronic
966557064 3:181274491-181274513 CAGATTCAGTAAGTCTGGGGTGG - Intergenic
966810651 3:183841131-183841153 CGAAATCAGAATATCTGGGGTGG + Intronic
966989370 3:185213316-185213338 CTGATTCATTAAATCTGGGGTGG - Intronic
967017308 3:185493962-185493984 CTGAATCAGAATCTTGGGAGTGG - Intronic
967079541 3:186036633-186036655 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
967082279 3:186061267-186061289 TTAAATCAGAAATTCTGGGGTGG - Intronic
967613529 3:191537134-191537156 CTGACTCAGTACCTCTGGAGTGG + Intergenic
967773814 3:193363547-193363569 CTGAATTAAAAACTCTGGGTGGG + Intronic
967881918 3:194307543-194307565 CTGAATCAGAAACTGGGGGTGGG - Intergenic
967881927 3:194307557-194307579 CTGATTCAGTAATCCTGGGGTGG + Intergenic
967988861 3:195116381-195116403 CTGAGTCAGTAGGTCTGGGGTGG + Intronic
968047671 3:195632965-195632987 CTGAATCAGAAGATCTGGGAGGG - Intergenic
968055839 3:195691230-195691252 CTGAATCGGAAGGTCTGGGGTGG - Intergenic
968055873 3:195691338-195691360 CTGAATCGGAAGGTCTGGGGTGG - Intergenic
968099731 3:195956649-195956671 CTGAATCGGAAGATCTGGGGTGG + Intergenic
968099741 3:195956684-195956706 CTGAATCAGAATATCATGGGTGG + Intergenic
968099754 3:195956721-195956743 CTGAATCAGAAGATCGGGGATGG + Intergenic
968099767 3:195956758-195956780 CTGAATCGGAAGGTATGGGGTGG + Intergenic
968099780 3:195956794-195956816 CTGAATCGGAAGATCTGGGGTGG + Intergenic
968099832 3:195956972-195956994 CTGAATCGGAAGATCTGGGGTGG + Intergenic
968099951 3:195957365-195957387 CTGAATCGGAAGATCTGGGGTGG + Intergenic
968116757 3:196096319-196096341 CTGATTCAGAAGGTCTGGTGGGG + Intergenic
968149494 3:196325806-196325828 CTGAATCAGAAACTCTGGGGAGG + Intronic
968193745 3:196690147-196690169 CTGATTCAGTAAGTCTGGGGTGG - Intronic
968217089 3:196901971-196901993 CTGAATCAGAAACTGGAGGTGGG + Intronic
968276853 3:197446689-197446711 CTGAATCAGAAACTGGGGGTGGG + Intergenic
968306941 3:197656959-197656981 CTGAATCAGAAGATCTGGGAGGG + Intergenic
968676348 4:1882838-1882860 CTGCATCATGAACTCTGGAGTGG + Intronic
969042224 4:4308020-4308042 CAGAATCAGAATCTCTGATGTGG - Intronic
969051428 4:4376015-4376037 CTGATTCAGCAAGTCTGGGGTGG + Intronic
969219265 4:5748941-5748963 TTAAGTCAGAAACTCTGGGATGG - Intronic
969228859 4:5816089-5816111 CTGACTCAGAATCTCTGGGATGG - Intronic
970028492 4:11650015-11650037 CTGATTCACGAAGTCTGGGGTGG - Intergenic
970242742 4:14026350-14026372 TTGAATCATAAACTCTGAGTGGG + Intergenic
970384153 4:15539211-15539233 CTGAACCTGAAACCCTGAGGTGG + Intronic
970489231 4:16555163-16555185 TTGAATCAGAATCTCTGTGAGGG - Intronic
970669129 4:18376255-18376277 TTAAGTCAGAAACTCTTGGGTGG - Intergenic
970882173 4:20945182-20945204 CTGAATCAGTAGGTCTGGGTAGG - Intronic
970887435 4:21002662-21002684 CTCAATCAGAATCTCTGGGGTGG + Intronic
970926120 4:21454314-21454336 GTAAATCAGAAACTCTGGGGAGG + Intronic
970926351 4:21457001-21457023 CTGAATCTGAAAATCTTTGGTGG + Intronic
971172947 4:24252273-24252295 CTGATTCAGTAGATCTGGGGAGG - Intergenic
971226781 4:24761429-24761451 CTGATTCAGTGAGTCTGGGGTGG + Intergenic
971235137 4:24834740-24834762 CTGAATCAGAAACTCTGGAGTGG + Intronic
972265060 4:37452244-37452266 CTGAATCAATACGTCTGGGGTGG + Intergenic
972578310 4:40372387-40372409 CTGCATCAGAGACCCTGGAGGGG + Intergenic
972730970 4:41794724-41794746 CTGATTCAGTATGTCTGGGGTGG - Intergenic
972776837 4:42249428-42249450 CTGAATTAGAATCTCTGAGTTGG - Intergenic
972818695 4:42674382-42674404 CTGAATCCGAGCTTCTGGGGTGG - Intergenic
973232717 4:47860820-47860842 CAAAATCAGAAACTCTAGAGGGG + Intronic
973534127 4:51864226-51864248 CAGAACCAGAAACTCTGGGGTGG - Intronic
973583897 4:52371955-52371977 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
973691471 4:53437598-53437620 CTGATTCAGTAAGTCTGGGGTGG - Intronic
973875438 4:55213557-55213579 CTGAATCAGAAGCTGTGGTGAGG + Intergenic
974013800 4:56630787-56630809 TTAAATCAGAATCTCTGGGGTGG + Intergenic
974429645 4:61779296-61779318 CTGAATCTGAAACTCTGCGGGGG + Intronic
974539613 4:63217611-63217633 CTGGATATGAAACTCTGGGTTGG + Intergenic
975066568 4:70073424-70073446 CTAAATCAAAAACTCTGGTTTGG + Intergenic
975197374 4:71541548-71541570 CTGCATCTAAAACTCTGAGGAGG - Intronic
975278333 4:72529358-72529380 CTGAGTCAGAAAGTCTGTGGTGG + Intronic
975278492 4:72532223-72532245 CTAAATCAGAAACTCTGAGGTGG + Intronic
975366764 4:73538698-73538720 CTGGATCTGAAACTCGGGGTGGG - Intergenic
975535097 4:75441772-75441794 GAGAATCAGCATCTCTGGGGGGG + Intergenic
975611477 4:76208118-76208140 CTGATTCAGCAAGTCTGGGATGG + Intronic
975833706 4:78398352-78398374 CTGATTCAGAAAGTCTGTGGTGG + Intronic
976090457 4:81451974-81451996 GTCGATCAGAATCTCTGGGGTGG - Intronic
976198116 4:82552672-82552694 TTAAATCAGAATCTCTGGGTGGG - Intronic
976208340 4:82642785-82642807 GTGAATCAGAATCTCTGGTCTGG + Intronic
976522437 4:86044337-86044359 TTAAATCAGAATCTCTGAGGTGG - Intronic
976607080 4:86994004-86994026 CTGATTCAGGAAATCTGGGATGG + Intronic
976745964 4:88403252-88403274 CTGAAGCAGAAACTATGGGGTGG + Intronic
976844983 4:89478343-89478365 CTGAATATGAAATTCTGGGTTGG - Intergenic
976880656 4:89920869-89920891 CTGAATGAGAATCTCAGGTGAGG + Intronic
976897832 4:90133030-90133052 TTGATTCAGAAGCTCTGGGGTGG + Intronic
977124215 4:93144084-93144106 CTGAATGAGAAACTGGGGTGCGG - Intronic
977296624 4:95216898-95216920 CTGAATCAGAAACTCGGGGTAGG - Intronic
977301139 4:95269181-95269203 TTAAATCAGAATCTCTGGGTGGG + Intronic
977363473 4:96036044-96036066 CTGAGTCAGAAACTCTTGAATGG - Intergenic
978143283 4:105341921-105341943 CTGATTCAGCAAGTCTGGGATGG - Intergenic
978200465 4:106019063-106019085 TTGATTTAGTAACTCTGGGGTGG + Intergenic
978228370 4:106366617-106366639 CTGAAACAGAATCTCAGGAGTGG - Intergenic
978398147 4:108304331-108304353 CTGAACCAGAAACTCTGGGGTGG - Intergenic
978588271 4:110295968-110295990 CTGAAATAGAAATTCTGGAGAGG + Intergenic
978840071 4:113201314-113201336 CTGAATCAGAAACCCTGGGGAGG - Intronic
978971828 4:114817134-114817156 ATGAGTCAGAAACTGTGGGTAGG - Intergenic
979357782 4:119725861-119725883 CTGATTCAGAAGCTGTGGGTGGG + Intergenic
979636336 4:122958624-122958646 CTGAATCAGAAACTCTTGTCAGG - Intronic
979717980 4:123864588-123864610 CTTGATCAGAAAGTCCGGGGAGG - Intergenic
980125905 4:128774060-128774082 GTGAATCAGAAACTCAGAGTGGG - Intergenic
980177866 4:129368504-129368526 CTGAATCAGAAACTTGGAGGTGG + Intergenic
980805433 4:137807153-137807175 CTGATTCAGTAAGTCTAGGGTGG - Intergenic
980835374 4:138185591-138185613 CTGAATTGGAAACTGTGGGGTGG - Intronic
981143568 4:141299734-141299756 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
981522659 4:145679593-145679615 CTAAATCAGAATCTCTGTGGTGG + Intergenic
982174607 4:152694038-152694060 CTGATTCAGTAGCCCTGGGGTGG - Intronic
982673377 4:158348588-158348610 CTGATTCAGTAGGTCTGGGGTGG - Intronic
983042977 4:162952638-162952660 CTGAAGCAGAAGCTCTGAGCTGG - Intergenic
983312474 4:166082209-166082231 CTGAATCAGAAGTTCTGGTGTGG - Intronic
983396284 4:167200655-167200677 TGAAATCAGCAACTCTGGGGAGG - Intronic
983524595 4:168748291-168748313 TTGAACCAGAAACTCTGGGGTGG + Intronic
983567932 4:169174433-169174455 CTGATTCAGTACCTCTGGGTGGG + Intronic
983924873 4:173389606-173389628 CTGATTCAGTAGGTCTGGGGAGG + Intronic
984516295 4:180745178-180745200 TGGAATCAGAAACTCTGGTCGGG + Intergenic
984635472 4:182105248-182105270 CTGAATCAGAAAGGTCGGGGAGG - Intergenic
984795590 4:183657876-183657898 CTGAATCAGAATTTCTGTGGTGG - Intronic
984795596 4:183657890-183657912 CTGATTCAGTAGGTCTGGGGTGG + Intronic
985029809 4:185778275-185778297 CTGAATCAGACGCTCTGGGGTGG - Intronic
985251841 4:188032216-188032238 CTGAATCAGGAGCTCTGGGCTGG - Intergenic
985503764 5:266010-266032 CTGAATCGGAAGGTCTGGGGTGG - Intergenic
985826772 5:2197902-2197924 CTTCATCAGAGACTGTGGGGAGG - Intergenic
986038518 5:3963536-3963558 CTGAGTCATAAACTCAGGGAAGG + Intergenic
986327513 5:6687324-6687346 CTGTATCTGAAACGCTGGGACGG + Intergenic
986363596 5:7006606-7006628 CTAATGCAGAAAGTCTGGGGTGG + Intergenic
986638432 5:9847972-9847994 CTGAATCAGAAACTCTGGAGTGG + Intergenic
986749378 5:10772879-10772901 CTAAATCTGAAACCCTGGGCTGG + Intergenic
987276771 5:16371375-16371397 CTAAATCAGTAGTTCTGGGGTGG - Intergenic
987280661 5:16410701-16410723 CTGCATCAGAATCTCAGGGGTGG + Intergenic
987287982 5:16478391-16478413 CTGAATCAGAAACTCTGGGCTGG + Intronic
987369256 5:17178453-17178475 CTGATTCAGTAACTCTTGGACGG - Intronic
988444648 5:31271899-31271921 CTAAATCAGAATTTCTGGGGAGG - Intronic
988466852 5:31499715-31499737 CTGAATCAGAAACTGGGAGTGGG - Intronic
988689980 5:33562123-33562145 CTGATTCAGTAGGTCTGGGGAGG + Intronic
988976513 5:36521662-36521684 CTGAGCCAGAATCTCTGGGAGGG + Intergenic
989108695 5:37886932-37886954 CTGGATCAGAAACTCGGGCTGGG + Intergenic
989657234 5:43758342-43758364 CTGGATCTGAAATTCTGGGTTGG + Intergenic
990012266 5:51013710-51013732 ATGAATCAGAAGCCCTGGGTTGG - Intergenic
990012715 5:51019761-51019783 CTGAATCAGAATCACTGATGCGG + Intergenic
990228340 5:53682429-53682451 CTAGATCAGAATCTCTGGTGGGG - Intronic
990374734 5:55158146-55158168 CTGACTCGGGAAGTCTGGGGTGG + Intronic
990533556 5:56697642-56697664 CTGAATCAGAAACTCCGGGGTGG - Intergenic
990542169 5:56784448-56784470 CTGATTCAGGAGGTCTGGGGTGG + Intergenic
990731369 5:58812370-58812392 CTGATTCAGGAGGTCTGGGGTGG - Intronic
990758534 5:59102742-59102764 CTGATTCAGTACTTCTGGGGTGG - Intronic
990958143 5:61364204-61364226 CTGAAATAGAAACTATGGGCCGG - Intronic
990968911 5:61481515-61481537 CTGAATCAGAATCTTTGCTGGGG - Intronic
990980548 5:61599038-61599060 CTGATTCAGTAAGTCTGGGGTGG + Intergenic
991255095 5:64604597-64604619 CTCAGTCAGTAGCTCTGGGGTGG - Intronic
991602324 5:68366054-68366076 CTAAATCAGAAACTCTTGGCTGG + Intergenic
991619448 5:68530483-68530505 CAGAATCAGAAATTCTGGGGTGG - Intergenic
991929607 5:71740274-71740296 TTGAATCAGAAACTCTGAGGTGG + Intergenic
992202219 5:74395673-74395695 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
992532933 5:77670073-77670095 CTGATTCAGTAAGTCTGGAGTGG - Intergenic
992625580 5:78633470-78633492 GGGACTCAGAATCTCTGGGGTGG + Intronic
992771905 5:80056209-80056231 CTGAATCCGAATCTGTCGGGTGG + Intronic
992818158 5:80465707-80465729 CTTAATCAGAAACTATGTAGAGG - Intronic
992827196 5:80562245-80562267 GTGATTCAGTAGCTCTGGGGTGG - Intronic
992948442 5:81832775-81832797 CTGAATCAGAAACTATGGGATGG - Intergenic
993101611 5:83547297-83547319 CTGAATCACATACTTTGAGGTGG - Intronic
993365266 5:87027631-87027653 ATGAACCAGAACCTCTGGGATGG - Intergenic
993386188 5:87266450-87266472 CTGATTCAGAAGGTCTGAGGTGG + Intergenic
993764696 5:91841636-91841658 CTGTATCAGAAGCTCTTTGGAGG - Intergenic
993871495 5:93259994-93260016 CTGATTCACTAAATCTGGGGCGG - Intergenic
993965798 5:94359213-94359235 TTAAATCAGAATCTCTGGGGTGG - Intronic
994150098 5:96437688-96437710 CTGATTCAGTAGTTCTGGGGTGG - Intergenic
994927777 5:106140797-106140819 TTGAATCAGAAAATCTGGGGTGG - Intergenic
994993885 5:107034851-107034873 CTGATTCAGTACCTCTGGGTGGG - Intergenic
995507424 5:112874678-112874700 CTGATTCAGGAAGTCTGGGGTGG - Intronic
995674083 5:114642768-114642790 TTGAATCAGCAAACCTGGGGTGG + Intergenic
995900013 5:117054492-117054514 CTGATTCAGTAAGTCTGAGGGGG - Intergenic
996072386 5:119147951-119147973 CTGAATCTCAGACTCTGGGATGG + Intronic
996679353 5:126214336-126214358 CTGAGTCAGAAATTCTATGGTGG - Intergenic
996732580 5:126730097-126730119 CTGAATCAGAAACTCTGTGGTGG + Intergenic
996856120 5:128009459-128009481 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
997078120 5:130705187-130705209 CTGAATAAGAAACTCAGGGTAGG - Intergenic
997207524 5:132058838-132058860 TTGATTCAGAAAGTCTGGGCTGG + Intergenic
997614267 5:135235863-135235885 CTGAATCAGAAATCCTGGGGTGG - Intronic
997675488 5:135709484-135709506 CTGAGTCCGAACCTTTGGGGTGG - Intergenic
997680817 5:135749471-135749493 CTGAATCAGAAACTCAGAGCTGG + Intergenic
997736295 5:136215042-136215064 ATGAATCAGCATCTCTGGAGTGG - Intronic
997747946 5:136316070-136316092 CTGACTCAGTAAGTCTAGGGTGG - Intronic
998165043 5:139837992-139838014 CTGAACCCAAAACTCTGGGATGG + Intronic
998533103 5:142903214-142903236 CTGAATCAGAATCACCTGGGAGG + Intronic
998615249 5:143733402-143733424 CTGAATCAGAAACTTGGGACTGG - Intergenic
998685871 5:144524211-144524233 CTGATTCACTAAGTCTGGGGTGG - Intergenic
998914337 5:146997520-146997542 CTGAATCAGAAACTGGGGATGGG + Intronic
998971818 5:147600741-147600763 CTGACTCAGCAAGTCTGAGGTGG + Intronic
999091405 5:148939420-148939442 CTGAGTCAGAAACTCTGGGCGGG + Intronic
999292727 5:150437308-150437330 CTGAATCAGAAACTCGGGGTGGG + Intergenic
999312272 5:150559083-150559105 CTCACTCAGAACCTCTGGGGTGG + Intergenic
999540836 5:152570997-152571019 CTGATTCAGTAAGTCAGGGGTGG + Intergenic
999629184 5:153552560-153552582 TTAAATAAGAATCTCTGGGGAGG + Intronic
999629382 5:153554441-153554463 CCGAGTCAGTAAATCTGGGGTGG + Intronic
999651210 5:153769277-153769299 CTGATTCAGCAATTCTGAGGTGG - Intronic
999672786 5:153972347-153972369 CTGAATCAGACCGTCTGGGATGG - Intergenic
999793766 5:154968564-154968586 GTGAATCAGAAGCTTTGGTGTGG + Exonic
999819985 5:155217176-155217198 TTGAATCAGAAGCTCTGTGTGGG - Intergenic
999835379 5:155364657-155364679 CTGATTCAGCAAGTCTCGGGTGG - Intergenic
999921201 5:156322995-156323017 TAGAATCAAAACCTCTGGGGTGG + Intronic
1000088229 5:157907333-157907355 CTGAATCAGGATCTCTGGGGTGG - Intergenic
1000163532 5:158624852-158624874 ATGAATCAGAAACTCTGGGGTGG - Intergenic
1000231985 5:159324490-159324512 CTGAATCAGAAACCTTGGGATGG + Intronic
1000761948 5:165236994-165237016 CTGAGTCAGAAACTCTGAGATGG + Intergenic
1000885734 5:166745540-166745562 CTGAATCAGCATCTCTGGGGAGG - Intergenic
1000905303 5:166959141-166959163 TTAAGTCAGAAACTCTAGGGTGG - Intergenic
1001003610 5:168030478-168030500 GCAAATCAGAAACTCAGGGGTGG - Intronic
1001102892 5:168828752-168828774 CTGAATCAGGAACCCTGGGGTGG + Intronic
1001123525 5:168998859-168998881 CTGAATCAGAAATTCTGGGAGGG + Intronic
1001127084 5:169029430-169029452 CTGCATCAGAGACTGTGGGGTGG + Intronic
1001206656 5:169769639-169769661 CTGACTCTGAATATCTGGGGAGG + Intronic
1001218175 5:169875257-169875279 CTGAATCAGAGAGTGTGGGGTGG - Intronic
1001231144 5:169989903-169989925 CTGAAGCAGCAAATCTGGGCTGG + Intronic
1001280680 5:170384155-170384177 GTGAATCAGAACTTCTTGGGTGG + Intronic
1001441315 5:171745234-171745256 CAGAATCAGAAGCTCAGGGTTGG + Intergenic
1001488045 5:172133970-172133992 CTGAATCAGAAGCTCTGGAGTGG - Intronic
1001519732 5:172382461-172382483 CTGGATCAGAAACTCGGGTGGGG - Intronic
1001543030 5:172552392-172552414 CTGAATCAGAAACCCTGGGGAGG + Intergenic
1001563387 5:172684319-172684341 CTGAATCCGGAACTCTGGGGTGG - Intronic
1001571189 5:172731810-172731832 CTGAATCAGAAACTCTGGGGTGG - Intergenic
1001682939 5:173571995-173572017 CTGAATCAGAAACTCTGAGGTGG + Intergenic
1001687735 5:173607219-173607241 CTGATTAAGAAGTTCTGGGGTGG - Intergenic
1001860641 5:175051824-175051846 CTGAATCGGAGATTCTGGGATGG - Intergenic
1002206379 5:177565564-177565586 CTGAATCAGACACTTTGAGGTGG + Intergenic
1002301399 5:178259370-178259392 CTGAATCAGAGACTCTGGGATGG - Intronic
1003037863 6:2660890-2660912 CTGATTCAGAAGTTCTGGGCGGG - Intergenic
1003227640 6:4220842-4220864 TTGCATCAGAATCTCTAGGGTGG + Intergenic
1003250939 6:4428801-4428823 CTGATTCAAAAGGTCTGGGGTGG - Intergenic
1003330511 6:5124787-5124809 CTAACTCATAATCTCTGGGGAGG - Intronic
1003486684 6:6586311-6586333 CAGGAGCAGAAACTCTGGGGTGG + Intergenic
1003525575 6:6894028-6894050 CTGAATCAGAAACGTGGGGGTGG - Intergenic
1003534914 6:6968443-6968465 CTGAATCAGAAATACTGGGGTGG + Intergenic
1003572893 6:7267592-7267614 CTGACTCAGAATTTCGGGGGTGG + Intergenic
1003584144 6:7371192-7371214 CTGATTCAGTAATTCTGGGGTGG - Intronic
1003682068 6:8266331-8266353 CTGCCTTAGAATCTCTGGGGTGG - Intergenic
1003834962 6:10060974-10060996 TTGGATCAGTATCTCTGGGGAGG - Intronic
1003941768 6:11035350-11035372 CAGAATGAGAATCTCTGAGGAGG - Intronic
1004096168 6:12556617-12556639 CTGATGCAGTAAGTCTGGGGTGG + Intergenic
1004199621 6:13535679-13535701 CTGGATCAGAATCTCTGGTGTGG - Intergenic
1004204940 6:13583731-13583753 CTGATTCAGCAGCTCTGAGGTGG + Intronic
1004265656 6:14146312-14146334 CTGAATCAGATGCTCTTGGCAGG + Intergenic
1004278368 6:14257917-14257939 CTGAATCAGCAACCCTGAGTGGG + Intergenic
1004344974 6:14840735-14840757 GTGATTCAGTAAGTCTGGGGTGG + Intergenic
1004352915 6:14906416-14906438 CTGCATCAGAATCTCAGGGGTGG - Intergenic
1004566771 6:16805348-16805370 CTGCATCAGAATCTCTCTGGGGG - Intergenic
1004569391 6:16830962-16830984 CTGAATCAGAAACTCTGGGGAGG - Intergenic
1004729322 6:18342438-18342460 CTGAATCAGAGACTTCAGGGAGG + Intergenic
1004865329 6:19847621-19847643 ATGAATCAGAATCTCAGTGGTGG - Intergenic
1004923256 6:20396382-20396404 CTGAATCCGAACCTCTGGTAGGG - Intergenic
1005029943 6:21499401-21499423 CTGATTCCGAAGGTCTGGGGTGG - Intergenic
1005488045 6:26319899-26319921 CTGAATCAGAAACTGGGCGTGGG + Intergenic
1005703907 6:28431507-28431529 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1005712382 6:28514673-28514695 CTGAATCAGAAAGTCTTGGGTGG + Intronic
1005987952 6:30885722-30885744 CTGTCTCAGAAACTCTGTGAGGG + Intronic
1006319460 6:33311865-33311887 TTAAATCAGAATCTCTGGGGTGG - Intronic
1006376128 6:33672624-33672646 CTGAGTCAGGAACACTGGAGAGG + Intronic
1006719424 6:36140521-36140543 CTGAGTCACAAGCCCTGGGGTGG - Intronic
1006839019 6:37016191-37016213 CTGAATCAGGAGGTCTGGGTGGG + Intronic
1006904815 6:37526107-37526129 CTGATTCAGTAAACCTGGGGTGG - Intergenic
1007167127 6:39836618-39836640 CTAAATCAGAAACTCTGGGGTGG + Intronic
1007446851 6:41913168-41913190 CTAAGTCAGAAACTTTGGCGTGG + Intronic
1007469599 6:42080101-42080123 CTGAATCACAAACCCTGAGAAGG - Exonic
1007488270 6:42197580-42197602 CTGAATCAGGAACTGTGGGCTGG + Intergenic
1007796500 6:44352847-44352869 CGTAAGCAGACACTCTGGGGAGG - Exonic
1007801283 6:44395683-44395705 CTGAGTCAGTACATCTGGGGTGG + Intronic
1007829500 6:44627633-44627655 CAGCATCAGAACCACTGGGGAGG - Intergenic
1007918780 6:45587007-45587029 CTGATTCAGTTTCTCTGGGGTGG + Intronic
1007928023 6:45665542-45665564 CTGATTCAGAAGTTCTGGAGTGG + Intergenic
1007931975 6:45699967-45699989 CCGAATCAGTAAGTCTGAGGTGG + Intergenic
1008036452 6:46749958-46749980 CAGAATCTGAAACTCTGGGCAGG - Exonic
1008056721 6:46953197-46953219 CAGATTCAGTAAATCTGGGGAGG + Intronic
1008127102 6:47681099-47681121 CTGATTCATTAAGTCTGGGGTGG + Intronic
1008162107 6:48091403-48091425 CTGATTCAGAAGGTCTGGGTGGG - Intergenic
1008258399 6:49333496-49333518 GTGAATCATAAACTCTGGGATGG - Intergenic
1008441080 6:51532412-51532434 CTGATTCAGAAAAGCTGGGGTGG - Intergenic
1008583717 6:52929932-52929954 CTGATTCAGTAAGGCTGGGGTGG + Intergenic
1008666163 6:53718659-53718681 CCGAATCAGAATCTCTAGGCGGG - Intergenic
1009519857 6:64667975-64667997 CTGAATGAAAAACTCTGGGATGG - Intronic
1009551654 6:65103118-65103140 CTGAATCAGTAACTGGGGAGAGG + Intronic
1009815781 6:68732906-68732928 CTGGATCAGAAACTCTGGAGTGG - Intronic
1009903715 6:69842010-69842032 CTGATCCAGTAAGTCTGGGGTGG + Intergenic
1010152347 6:72748427-72748449 CTGATTCATTAAGTCTGGGGTGG - Intronic
1010208088 6:73341016-73341038 CTGAGTCAGAAATTCTTGGGTGG - Intergenic
1010233132 6:73553141-73553163 TTGAACCACAATCTCTGGGGTGG + Intergenic
1010768074 6:79798804-79798826 CTAAAACAGAAACTCTGGGGGGG - Intergenic
1010769555 6:79812655-79812677 CTGATTCAGCAAGTCTGGGATGG - Intergenic
1011007936 6:82668959-82668981 CTGATTCAGTAAGTCTGGAGTGG - Intergenic
1011329622 6:86189106-86189128 TTTAATCAGAATCTCTGGGAGGG - Intergenic
1011581161 6:88867056-88867078 CTGATTCAGAAAGTCTAGGCTGG - Intronic
1011664645 6:89622440-89622462 CAGGATCAGAAACTCGGGTGGGG + Intronic
1011913260 6:92468646-92468668 TGGAATTTGAAACTCTGGGGTGG - Intergenic
1012259787 6:97074222-97074244 CTGAAACAGGAACTCTGGAGTGG - Intronic
1012280424 6:97321621-97321643 CTGATTCAGTAAGTCTGGGTGGG - Intergenic
1012394131 6:98776211-98776233 CTCAATCAAAAACTTGGGGGTGG + Intergenic
1013018962 6:106191157-106191179 TTGATTCAGAAAGTCTGGAGAGG - Intronic
1013068340 6:106705095-106705117 CAGAATCAGAAACTCTGGAATGG + Intergenic
1013208680 6:107967575-107967597 CTGAATCAGAAACTCTGGCTTGG - Intergenic
1013210168 6:107979840-107979862 CTAATTCAGAAAATCTGGTGTGG + Intergenic
1013296449 6:108761975-108761997 CTGAATCAAAATGTCTGGGGCGG + Intergenic
1013372113 6:109480081-109480103 CTAAATCAGAAGCTCTGGGGTGG + Intronic
1013522570 6:110946526-110946548 CTAAATCAGAAATGCTGGGAAGG - Intergenic
1013941376 6:115667275-115667297 CTGATTCAGGAGTTCTGGGGTGG - Intergenic
1014151982 6:118067831-118067853 CTGAATCAGACACTCAGGAGTGG - Intronic
1014165709 6:118222162-118222184 TTGAGTCAGAAAGTCTGGGGTGG + Intronic
1014264790 6:119264183-119264205 CTGATTCAGTAAATCTGGGTTGG - Intronic
1014274398 6:119370273-119370295 CTGATTCAGTAAGTCTGGGGCGG + Intergenic
1014558008 6:122856513-122856535 CTGAATCAGAAACACTGGAGGGG - Intergenic
1014641379 6:123914976-123914998 CTGAATCAAAGTCTCTGGGAAGG + Intronic
1014687037 6:124514477-124514499 CTGAATTAGAATCTCTAGGAGGG + Intronic
1014916412 6:127154758-127154780 CTGAATCAGAAACTCTGGTGGGG + Intronic
1014991242 6:128079938-128079960 CTGATTCAGTATTTCTGGGGAGG + Intronic
1015140344 6:129923651-129923673 TGGAATAAGAAACTCTGGGCAGG + Intergenic
1015411594 6:132899602-132899624 CTGCATCAGAAATTCTGGAGGGG + Intergenic
1015805323 6:137102524-137102546 CTGAGTCAGAAAGTTTGGGGTGG + Intergenic
1015982934 6:138857343-138857365 CTGAGTCTGAAACTCTAGGTGGG - Intronic
1016227209 6:141752844-141752866 CTGAATCAGAAACAAAGTGGAGG + Intergenic
1016341484 6:143066110-143066132 CTGATTCAGAAGCTCTGGGGTGG - Intronic
1016547868 6:145244539-145244561 CTGATTCAGTAGATCTGGGGTGG + Intergenic
1016595707 6:145797518-145797540 GTGAATCAGGAACTCTGGGGTGG - Exonic
1016920288 6:149285840-149285862 ATGAATCAGAAACTCCAGGGAGG - Intronic
1017648956 6:156563683-156563705 CTGAATCAGAAACTTGGTTGTGG - Intergenic
1017648961 6:156563697-156563719 CTGATTCAGGAAGTCTAGGGTGG + Intergenic
1017704759 6:157111901-157111923 CTGAATTGGAAACTTGGGGGTGG - Intronic
1017795068 6:157836547-157836569 CTGATTCAGGAGGTCTGGGGTGG + Intronic
1017951648 6:159140314-159140336 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1018155119 6:160978337-160978359 CTGAGTCAGAGCCTCTGAGGAGG - Intergenic
1018329490 6:162711945-162711967 CTGAATCAGAGATTCTGGTCGGG + Intronic
1018388276 6:163323743-163323765 CTGAATCAGAAACTTTGGGATGG + Intergenic
1018400509 6:163415231-163415253 CTGCATCAGGTAATCTGGGGTGG - Exonic
1018421755 6:163646333-163646355 GTGAACCAGAAAGTCTGGGGTGG - Intergenic
1018474135 6:164123478-164123500 CCCAAACAGAAACTCTAGGGCGG + Intergenic
1018615330 6:165681495-165681517 CTGAATCAGAAACTCGGAGGAGG - Intronic
1018914366 6:168123807-168123829 CCGAATCAGCCACTCTGGGGTGG - Intergenic
1018975745 6:168563975-168563997 CTGGAGTAGAACCTCTGGGGTGG + Intronic
1019157594 6:170049675-170049697 CTGCATCAGGAAGGCTGGGGAGG + Intergenic
1019364318 7:624050-624072 CTGATTCAGAAGCTCAGGGCTGG - Intronic
1019961993 7:4468238-4468260 CTGACTCAAAAAGTCTTGGGTGG - Intergenic
1020245363 7:6425073-6425095 TTCAATCCGAATCTCTGGGGAGG - Intronic
1020438693 7:8194247-8194269 CTGAATCAGAATCTTTGGGGCGG + Intronic
1020912843 7:14155019-14155041 CTGAATCAGAAGATCTGGGGTGG - Intronic
1021397213 7:20165234-20165256 CTGGATTAGAAACACTGGGGTGG - Intronic
1021462890 7:20909180-20909202 TTAAATCAGAATCTCTGGGATGG - Intergenic
1021548631 7:21844709-21844731 CTAAATGAGAAACTCTGGTTGGG + Intronic
1021572756 7:22082727-22082749 CCTAATCAGAAACTCCAGGGTGG + Intergenic
1021606323 7:22412825-22412847 CTGATTCAGGAGGTCTGGGGTGG + Intergenic
1021682613 7:23149529-23149551 CTGAATCAGAAATGCTAGGGAGG - Intronic
1021687785 7:23204253-23204275 CTGATTCAGTAAGTTTGGGGTGG - Intergenic
1021888667 7:25165731-25165753 CTGTTTCAGTAAATCTGGGGTGG + Intronic
1021937858 7:25648800-25648822 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1022127423 7:27371915-27371937 TTGAATCAGAAACTCGGGGTGGG + Intergenic
1022216297 7:28265588-28265610 CTGAGTCAGAATCTCTGGGGTGG - Intergenic
1022337486 7:29435335-29435357 CTGACTCAGAAAGTCTGAGCTGG - Intronic
1022338498 7:29446074-29446096 TTACATCAGAAACTCTGGGTAGG + Intronic
1022403299 7:30062357-30062379 CTGATTCAGTAACTCGGGTGGGG + Intronic
1022403680 7:30065927-30065949 CTGATTCAGCAGGTCTGGGGTGG - Intronic
1022568416 7:31427091-31427113 CTCAATCAATAAGTCTGGGGTGG + Intergenic
1022847820 7:34228446-34228468 CTGACTCAGTAGGTCTGGGGTGG + Intergenic
1022867688 7:34439229-34439251 TTGAATCAGAAATTCTAGGCTGG + Intergenic
1022939241 7:35216218-35216240 CTGAGACAGAAACTCTAGGATGG - Intronic
1022949455 7:35321922-35321944 TTGAATTAGAAAATCTGGGGTGG + Intergenic
1023092941 7:36633245-36633267 CTGAATTGAAAACCCTGGGGTGG + Intronic
1023371374 7:39515726-39515748 CTGAAGCAGTAGGTCTGGGGTGG - Intergenic
1023395210 7:39745628-39745650 CTGAATCAGAGACTCAGGGGTGG - Intergenic
1023473899 7:40555617-40555639 CTGAATCAGACACTCAGAAGTGG - Intronic
1023689167 7:42768364-42768386 TTGAGTCAGAAACTCTAAGGTGG + Intergenic
1024307798 7:47942809-47942831 CTAAAGCAGAAAGTCAGGGGTGG + Intronic
1024410697 7:49038077-49038099 CTGAATCAGAAACTCAGAATGGG + Intergenic
1024573195 7:50742547-50742569 CTAAACCAGAAACTCAGTGGAGG + Intronic
1025988568 7:66477019-66477041 CTGAATCAGAAACTCTGGGGTGG - Intergenic
1026026903 7:66752717-66752739 TTGAATCAGAAACTCTGGGGTGG + Intronic
1026110414 7:67454938-67454960 CTGAATCAGAAACTCAGAGGAGG + Intergenic
1026254586 7:68699470-68699492 CTGACTCAGTAGCTTTGGGGTGG + Intergenic
1026302433 7:69109515-69109537 CTGAGTCAGACAGTCTGGGGTGG + Intergenic
1026459391 7:70600046-70600068 CTGAATCAGAAACTAGGGTGGGG + Intronic
1026570345 7:71523821-71523843 CAGATTAAGAAACTCTGGGCTGG + Intronic
1026576344 7:71574725-71574747 CTGAATCAGAAACTCTGGAGTGG + Intronic
1026597898 7:71749845-71749867 CTGAATCCGAGACTCTGGAGTGG + Intergenic
1026602665 7:71789446-71789468 CTGATGCAGCAAATCTGGGGTGG - Intronic
1026602828 7:71790805-71790827 CTGAATCAGAAACTCCCGAGTGG - Intronic
1026677062 7:72436813-72436835 CTGAATCAGAAATTCAGAAGGGG + Intronic
1027211541 7:76153032-76153054 CTGAATCAGAAACTCTGGGGTGG - Intergenic
1027366967 7:77468666-77468688 CGGTATTAGAAACTCTGGGGCGG + Intergenic
1027409022 7:77893354-77893376 CTGATTCTGTAACTCTGGAGTGG + Intronic
1027859838 7:83563555-83563577 CTTAATCAGAAACTTTGGAGTGG + Intronic
1028077218 7:86531892-86531914 CTGAATAAGAAATTCTTGGTTGG + Intergenic
1028213389 7:88102290-88102312 CTGAATCAGAATCTCCAAGGAGG - Intronic
1028582097 7:92419279-92419301 CTGCATCAGTAGGTCTGGGGTGG - Intergenic
1028632546 7:92950854-92950876 CTGAATCAGAATCGCTCAGGTGG + Intergenic
1028938061 7:96487828-96487850 CTGATTCAGAAGATCTAGGGTGG + Intronic
1028979804 7:96954781-96954803 ATGTATAAGAAACTCTGGAGAGG - Intergenic
1028981396 7:96971313-96971335 CTGAATCAGAATCCCCAGGGTGG - Intergenic
1029417540 7:100452531-100452553 CTGAATCAAAAACCCTAGGATGG - Intergenic
1029798489 7:102921381-102921403 CTCTATAAGAAACTCTGGGCCGG + Intronic
1029849554 7:103447619-103447641 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1029966535 7:104746341-104746363 CTGAATGAGACTCTCTGGAGTGG - Intronic
1030073112 7:105714347-105714369 CTGAATGGGAATCTCAGGGGTGG + Intronic
1030079441 7:105764445-105764467 CTGAATCAGAAACTTGGGATGGG + Intronic
1030119312 7:106091905-106091927 CTAAATATGATACTCTGGGGAGG - Exonic
1030127606 7:106169264-106169286 TTGAATCAGAAACTCAGGGATGG + Intergenic
1030317172 7:108127660-108127682 CTGATTCACAGACTCTGGGATGG + Intronic
1030803972 7:113890387-113890409 CTGAATCAGCATCTCTGAGTGGG + Intronic
1031141039 7:117943972-117943994 CAGAATCAGAACATCTGGGTAGG + Intergenic
1031205876 7:118756971-118756993 CTGAGTCAGTAGCTCTGGGGTGG + Intergenic
1031234415 7:119155643-119155665 CTTAATCAGAATATCTGGGATGG - Intergenic
1031485946 7:122324497-122324519 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1031558735 7:123210766-123210788 TTGAATCAGAAACTTCGAGGAGG + Intergenic
1031843230 7:126772454-126772476 CTGACCCAGCAAGTCTGGGGTGG - Intronic
1031982425 7:128136330-128136352 CTTAACCCGTAACTCTGGGGCGG - Intergenic
1032215742 7:129955742-129955764 CTGACTCAGAAGTTCTGGGGTGG + Intergenic
1032329174 7:130961792-130961814 TGGACTCAGAATCTCTGGGGAGG + Intergenic
1032343712 7:131100067-131100089 CTGACTCAGAAGGTCTAGGGTGG - Intergenic
1032417053 7:131743810-131743832 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1032631652 7:133659636-133659658 CTGAATCAGAACCTCTGGGAAGG + Intronic
1032649434 7:133861469-133861491 GAGAATCAGAATCTGTGGGGTGG - Intronic
1032716462 7:134513031-134513053 CTGACTCAGAGGGTCTGGGGTGG + Intergenic
1033158327 7:138975053-138975075 CTGATTCAGAAGGTCGGGGGTGG + Intronic
1033172220 7:139094190-139094212 CTGATTCAGACACTCCAGGGTGG - Intronic
1033257724 7:139816640-139816662 CTGATTCAGTAATTCTGGGTTGG - Intronic
1033521895 7:142169027-142169049 CTAATTCAGAAAATCTGGGTTGG + Intronic
1033900443 7:146132358-146132380 CTGATTCAGTAAATCTGGAGTGG + Intronic
1034307341 7:150055219-150055241 CTGAAACAGAAACTCAGGGCTGG + Intergenic
1034777265 7:153839793-153839815 CTGAATCAGAAACAGGGGGGCGG - Intergenic
1034934387 7:155189254-155189276 CTGACTCAGTAATTCTGGGCTGG + Intergenic
1035126375 7:156610847-156610869 CTGAATCAGAAACTCTGGGAAGG - Intergenic
1035198100 7:157240016-157240038 CAGATTCAGAAGGTCTGGGGTGG - Intronic
1036207875 8:6818688-6818710 CTGAGACAGAATCTCTGAGGGGG + Intronic
1036474252 8:9078704-9078726 CTGAATCAGTGACTCCAGGGTGG + Intronic
1036475001 8:9085067-9085089 ATGAATCAGAAATTTGGGGGTGG + Intronic
1036578326 8:10049583-10049605 CTTGATCAGAAACTCTAGGATGG + Intergenic
1036614618 8:10378736-10378758 CTGAGCCAGAAGTTCTGGGGTGG - Intronic
1036778021 8:11626900-11626922 CTGAATTAGAATCCCTGGGAAGG + Intergenic
1036948861 8:13121883-13121905 GTGAATCAGAATACCTGGGGAGG - Intronic
1037097680 8:15004931-15004953 CTGAATCAGCATATCTGAGGTGG + Intronic
1037164450 8:15810179-15810201 CTGAATCAGAAATTTGGGGGTGG + Intergenic
1037192817 8:16147965-16147987 CTGCATCAGAAACTCTGGGGTGG + Intronic
1037443356 8:18940122-18940144 CGGCATCAGAAACTCTGGGATGG - Intronic
1037623690 8:20589411-20589433 CTGATTGACAAACTCTGGGATGG + Intergenic
1037778928 8:21854648-21854670 CTGAATCAGAAACTGGGGACAGG - Intergenic
1038456614 8:27675830-27675852 CTGAATCAGAGTTTCTGGGGGGG - Intronic
1038474736 8:27857456-27857478 CTGAATCAGAAACTCTGGGGAGG - Intergenic
1038474741 8:27857470-27857492 CTGATTCAGAAAGTCTGGATCGG + Intergenic
1038586804 8:28797101-28797123 CTGAATCTGAAACTCTGGGAGGG - Intronic
1038650943 8:29402601-29402623 GTGAATCACAGACTCTGGGGAGG + Intergenic
1038768548 8:30453956-30453978 CTGAATCAGAATTTCTGGGAGGG + Intronic
1038961320 8:32523529-32523551 CAGAATCAGAAGCTCTTTGGGGG + Intronic
1039411292 8:37357394-37357416 GTGAATAAAAAGCTCTGGGGAGG - Intergenic
1039560990 8:38512444-38512466 CTGAATTAGAAACCCTGGGGTGG - Exonic
1039820696 8:41131649-41131671 CTGAATATGAAATTCTGGGTTGG - Intergenic
1039974365 8:42348554-42348576 GTGAATGAGAAACTCTAGGGTGG + Intronic
1040039518 8:42902214-42902236 CTGAATCAGAATCTGTGTGTAGG - Intronic
1040907307 8:52481560-52481582 CTGACTGAGAACCCCTGGGGTGG + Intergenic
1041006852 8:53503919-53503941 CTGTGTCAGAAACTCTAGGGTGG - Intergenic
1041056631 8:53992632-53992654 CTGAATCAGGAATTCTGGTGGGG - Intronic
1041218485 8:55625247-55625269 CTAAAGCAGAAACTCTGAGCCGG + Intergenic
1041349354 8:56933201-56933223 CTGAGTCAGTAATTCTGGGGTGG + Intergenic
1041397337 8:57405044-57405066 CTGAATCAGAATCTCAGAGGTGG + Intergenic
1041513316 8:58674445-58674467 CTCAATCACAAACTATGGGTGGG - Intergenic
1041642066 8:60214006-60214028 CTGAATCAGCAACACAGGGGTGG + Intronic
1041650743 8:60299723-60299745 GGGAATCAGAAGCTCTGGGGAGG + Intergenic
1041902312 8:62995920-62995942 CTGAATCAGAAACTCTTGGGTGG + Intronic
1042012097 8:64258185-64258207 CTGATTCAGTAAATCTGGGGTGG - Intergenic
1042430320 8:68699094-68699116 CTGAATCAGAAAGTCTATGATGG + Intronic
1042600522 8:70494911-70494933 CTTAATCAGAAAATAGGGGGTGG - Intergenic
1043389718 8:79780800-79780822 CTGATTCACATACTCTGAGGGGG - Intergenic
1043393696 8:79815980-79816002 CTAAATCAGAAAGTCTGCTGTGG + Intergenic
1043420417 8:80091793-80091815 CTGAGTTAGAAAGTCTGGGGTGG + Intronic
1043474212 8:80590524-80590546 GGGAATCAGAAACTCTGGGGTGG + Intergenic
1043516911 8:81003109-81003131 ATGACTCAGACACTCGGGGGTGG + Intronic
1043823573 8:84898217-84898239 CTGGATCAGAAACTCTGGGGCGG + Intronic
1044069190 8:87735102-87735124 TTGAATCAGAAAATCTGGGTTGG + Intergenic
1044379387 8:91516265-91516287 CTGAATTAGAAACTCAGGGTTGG - Intergenic
1044407106 8:91840197-91840219 TTGAATCTGAATCTCTTGGGAGG + Intergenic
1044537735 8:93376455-93376477 CTGAATCAGAATCTCTAGGGAGG - Intergenic
1044563971 8:93643321-93643343 CTGAATCAGAAACCTGGGGATGG + Intergenic
1044605715 8:94045645-94045667 CTGAATCAGAATCTCTGAGGTGG - Intergenic
1044688724 8:94855091-94855113 ATGGATCAGAAATTCTGGGATGG + Intronic
1044883421 8:96747812-96747834 CTGAATTGGAATCTCTGGAGTGG + Intronic
1045242351 8:100413705-100413727 CTGAATCAGAATTTCTGGGTTGG + Intergenic
1045333305 8:101176271-101176293 TTAAATCAGGAACTCTGGAGTGG - Intergenic
1045438689 8:102189115-102189137 CTGAGTCAGAAGCCCTGGGTTGG - Intergenic
1045470635 8:102509205-102509227 CAGAATTAGAAACTCAGGGTGGG + Intergenic
1045615626 8:103907150-103907172 ATGAATCAGAAACTGTTGGTGGG - Intronic
1045824357 8:106379163-106379185 CTGCATCAGAAATTCTGGGATGG + Intronic
1045901649 8:107288542-107288564 CTGATTCAGTATGTCTGGGGTGG + Intronic
1046056332 8:109083283-109083305 CTGAATAGGCAAGTCTGGGGTGG + Intergenic
1046117300 8:109799571-109799593 CTGAATCAGAAAATATTGAGAGG + Intergenic
1046298195 8:112249378-112249400 CTGAGTACGAAACTCTGGAGGGG - Intronic
1046804528 8:118465150-118465172 TTAAATCAGAATCTCTGGGTAGG + Intronic
1046928419 8:119818220-119818242 CTGAATCAGAAATTGTGGGTAGG - Intronic
1046967159 8:120180633-120180655 TGGAACCTGAAACTCTGGGGGGG - Intronic
1047004261 8:120603572-120603594 CTGAATCAGAAACTCTTGCAGGG + Intronic
1047361509 8:124173386-124173408 TTGATTCAGAAATTCTGGCGTGG - Intergenic
1047364629 8:124200802-124200824 TTGAATCAGAAATACTGGGGTGG + Intergenic
1047450600 8:124962034-124962056 CTGACTCAGCACCTCTGGGGTGG - Intergenic
1047507217 8:125489331-125489353 CTTAATCAGAATATCTGGGGTGG + Intergenic
1047775200 8:128064550-128064572 CTGAATTAGAAAATCTGTTGGGG - Intergenic
1047907779 8:129491354-129491376 TTGGTTCAGAAACTCTGAGGTGG - Intergenic
1048059815 8:130907227-130907249 CTGAACCAGAAACTCGGCAGTGG + Intronic
1048086325 8:131184814-131184836 TTGAATGAAAAACTCTGGGATGG - Intergenic
1048188567 8:132266726-132266748 CTGAATCAGAAAGTCTGGAGTGG - Intronic
1048265472 8:132981706-132981728 CGGAATCAGACACTCTGGGGTGG + Intronic
1048296096 8:133215193-133215215 CTGATTCAACAAGTCTGGGGTGG - Intronic
1048481699 8:134801954-134801976 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1048486201 8:134849995-134850017 CTGAATCAGAATCTCAGGTGAGG - Intergenic
1048488443 8:134869898-134869920 CTGATTCAGTAGGTCTGGGGTGG - Intergenic
1048546801 8:135395202-135395224 CAGGATCAGAAACTAAGGGGAGG - Intergenic
1048607306 8:135982850-135982872 CAGAATCTGAAACTCAGGAGAGG + Intergenic
1049325422 8:142019071-142019093 CTGGAGCAGGAACTCTGGGGTGG - Intergenic
1049583581 8:143423203-143423225 CTGAATTAGGGAGTCTGGGGTGG - Intronic
1050051722 9:1608998-1609020 CTGGTTCAGCAAGTCTGGGGTGG + Intergenic
1050072037 9:1825285-1825307 TTTAATCAGAATCTCTGAGGTGG - Intergenic
1050118278 9:2282689-2282711 CTGCATCAGAAACTGCTGGGTGG + Intergenic
1050247272 9:3703789-3703811 CTGATTCAGGAATTCTGGGGAGG - Intergenic
1050249170 9:3725700-3725722 CTGAATAGGAAACTCTGGCAGGG + Intergenic
1050267099 9:3902631-3902653 CTGAATGAGCAGCTCTGGGGTGG - Intronic
1050291070 9:4155770-4155792 TTGAATCAGAAACTCTGGGATGG - Intronic
1050308566 9:4330317-4330339 TTGAATCAGAGACTCTGGATGGG - Intronic
1050376337 9:4977402-4977424 CTGATACAGAAAGTCTGGGTTGG + Intergenic
1050460858 9:5876191-5876213 CTGATTTAGTAAGTCTGGGGTGG + Intergenic
1050614017 9:7382837-7382859 TTAAATTAGAATCTCTGGGGAGG + Intergenic
1050702443 9:8355785-8355807 CTTATTCAGTAAGTCTGGGGTGG + Intronic
1051220530 9:14843793-14843815 CTGAATCAGAAATTCAGGGGTGG + Intronic
1051229645 9:14942425-14942447 TTAAATCAGAATCTCAGGGGTGG + Intergenic
1051235239 9:14992657-14992679 CTGATTCAGTAAGTCTGGGTAGG + Intergenic
1051619139 9:19033798-19033820 CTGAATCAGAAACTGGGGGTGGG - Intronic
1051753462 9:20369032-20369054 CTGAATCTGTAACTCCTGGGTGG - Intronic
1051848289 9:21477684-21477706 TTGAATCAGAAACAGTGGGATGG + Intergenic
1051883803 9:21868869-21868891 CTGAATCGGAAACTCTGGGGTGG - Intronic
1051885206 9:21885392-21885414 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1052042634 9:23756867-23756889 CTGAATCAGAATCTGTAGTGGGG - Intronic
1052083287 9:24233021-24233043 CTGAATCAAAAACTCTGGGATGG - Intergenic
1052083355 9:24233768-24233790 CTAAATCAAAAACTCTAGGATGG + Intergenic
1052083882 9:24239966-24239988 CTGATTCAGCAAGTCTGGGTGGG + Intergenic
1052948820 9:34191234-34191256 CTGAGTCAGTAGCTCTGGTGTGG + Intronic
1053070071 9:35096012-35096034 CTGATTCAGTAGATCTGGGGTGG - Intronic
1053114472 9:35489616-35489638 CCGACTCAGAACCACTGGGGTGG - Intergenic
1053279351 9:36807449-36807471 CTGACTCAGTAAGTCGGGGGTGG + Intergenic
1053361479 9:37489868-37489890 CTGAATAAAAAACTCTAGGCCGG - Intronic
1053370690 9:37559233-37559255 CAGAATCAGAATCTCTGGAGTGG + Intronic
1053405528 9:37872127-37872149 CAGAATCAGAAACTCTGGATGGG - Intronic
1053790595 9:41683631-41683653 CTGACTCAGTAGATCTGGGGTGG + Intergenic
1054178940 9:61895330-61895352 CTGACTCAGTAGATCTGGGGTGG + Intergenic
1054658597 9:67685501-67685523 CTGACTCAGTAGATCTGGGGTGG - Intergenic
1054820337 9:69515663-69515685 CTGATTCAGAAAGTATGGAGTGG - Intronic
1054820346 9:69515677-69515699 CTGAATCAGAAACTGGGGGGGGG + Intronic
1054944585 9:70782546-70782568 CAGAATCTTAAACTCTGGGTTGG + Intronic
1055148113 9:72960680-72960702 CTGAATCAGAAACTCTCGGGTGG + Intronic
1055269943 9:74546737-74546759 CTGCATCAGAATCTCTAGGTGGG - Intronic
1055319302 9:75066597-75066619 CAGAATCAGAAATTCTGGGGGGG - Intronic
1055426942 9:76206115-76206137 CTGAATTACAAATTCTGAGGTGG - Intronic
1055844309 9:80543142-80543164 CTGTATCATATGCTCTGGGGAGG - Intergenic
1055908568 9:81321005-81321027 TTAAATCAGACACTCTGGGAAGG + Intergenic
1056031498 9:82558468-82558490 TTGAATCAGAATCTCCAGGGTGG - Intergenic
1056079620 9:83078117-83078139 CTGAATCAGTAACTCGGGTGTGG + Intergenic
1056119912 9:83477461-83477483 TTAAATCAGAATCTCTGTGGAGG - Intronic
1056210823 9:84363672-84363694 CTGACTCAGAATGTCTGGGGTGG - Intergenic
1056715344 9:89023957-89023979 CTGACTCAGCAGATCTGGGGTGG + Intronic
1056728646 9:89144414-89144436 CTGAGTTAGAAATTCTGGGGTGG - Intronic
1056733921 9:89188821-89188843 CTGAGTCAGGAACCCTGGGGTGG - Intergenic
1056742084 9:89266210-89266232 GCTGATCAGAAACTCTGGGGTGG - Intergenic
1056966302 9:91165391-91165413 CTGCATCAGGAGGTCTGGGGCGG + Intergenic
1057232622 9:93333602-93333624 TTGAATCAGAATCTCTGGGTTGG - Intronic
1057252795 9:93517393-93517415 TTGAATCAGAATCTCTGGTTGGG + Intronic
1057414864 9:94852214-94852236 TTTAATCAGAATCTCTGGGGTGG - Intronic
1057474328 9:95385768-95385790 CTGGATTTGAATCTCTGGGGCGG + Intergenic
1057798233 9:98173178-98173200 CCGAATCAGAAACTCTAGGGTGG - Intronic
1057836490 9:98449546-98449568 CAGAATCAGAAGTTATGGGGTGG + Intronic
1057842944 9:98500886-98500908 CTGAATCAGACACTCCAGGGTGG + Intronic
1057846874 9:98532689-98532711 GTGAATCAGACACTGTGGGATGG - Intronic
1058001654 9:99872071-99872093 CTGATTCAGTAACTCTGGAGTGG - Intergenic
1058007889 9:99938927-99938949 CTGAATCAGAATCTCTAATGTGG - Intronic
1058057202 9:100460817-100460839 CTGAATCGGGATCTCTGAGGTGG + Intronic
1058115071 9:101076143-101076165 CTGATTCAGGAGGTCTGGGGTGG - Intronic
1058115080 9:101076157-101076179 CTGAATCAGACACTCTGGGGTGG + Intronic
1058734664 9:107883370-107883392 CTGATTCAGCAGGTCTGGGGTGG - Intergenic
1058817319 9:108696396-108696418 CTGAATCAGCCACTGTAGGGTGG - Intergenic
1058817326 9:108696410-108696432 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1058875611 9:109242248-109242270 CTGGATCAGAATCTATGGGGTGG - Intronic
1058906663 9:109487478-109487500 CTGAATCAGAGCCTCTGGTGAGG - Intronic
1058911983 9:109529327-109529349 CTAGATCAGAAACTCTGGGCTGG + Intergenic
1059057368 9:110998047-110998069 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1059064228 9:111065865-111065887 ACAAATCAGAAACTCTGGGCAGG + Intergenic
1059088118 9:111326509-111326531 CTGATTCAGTGACTCTAGGGTGG - Intergenic
1059167630 9:112094115-112094137 CTGAATCAGAACCTCTGGGATGG + Intronic
1059374791 9:113873656-113873678 ATGAATTCAAAACTCTGGGGTGG + Intergenic
1059473224 9:114523060-114523082 CTGATTCAGCAGATCTGGGGTGG - Intergenic
1059601157 9:115780824-115780846 CTGAATCAGAATCTTGGAGGTGG + Intergenic
1059661802 9:116408886-116408908 TTAAATCAGAAACTCTGGAGTGG - Intergenic
1059777848 9:117493780-117493802 CTGATTCAGTAAGTTTGGGGTGG - Intergenic
1059802592 9:117765227-117765249 CTGAATCAGAAGCACCGGGGTGG - Intergenic
1059802600 9:117765241-117765263 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1059847911 9:118302213-118302235 CTGAATTAGAACCTTTGTGGTGG - Intergenic
1059971483 9:119673211-119673233 CTGATTCAGTAAGTCTGGAGTGG + Intergenic
1060134407 9:121138098-121138120 CTGGATCAGAATCTCTAGAGTGG - Intronic
1060237592 9:121876833-121876855 CTGACTCAGAAACTCTGAGTGGG + Intronic
1060883027 9:127131921-127131943 CTGAATCAGAAACTGGGGGTGGG - Intronic
1061443589 9:130624406-130624428 CTGATTCAGTAGATCTGGGGTGG - Intronic
1061622821 9:131823010-131823032 CTGAATCTGAATTCCTGGGGAGG + Intergenic
1186149672 X:6661014-6661036 CTGAATCAGGAACTCTGAGGTGG - Intergenic
1186404536 X:9290388-9290410 CTGAATCAGGAACTCCTGGGTGG - Intergenic
1186562989 X:10632605-10632627 CTGAATCAGAAACTCTGGGGTGG - Intronic
1186575118 X:10757140-10757162 CTGACTCAGTAAATCTGGGTGGG + Intronic
1186708930 X:12172545-12172567 CTGATTCAGCAGGTCTGGGGTGG + Intronic
1186710667 X:12192749-12192771 AGGAATCAGAGGCTCTGGGGTGG - Intronic
1186806396 X:13144400-13144422 CTGAATCAGAAACTCTCAGGCGG + Intergenic
1186828484 X:13365690-13365712 TTAAATTAGGAACTCTGGGGTGG - Intergenic
1187120762 X:16403995-16404017 CTGATTCAGTGAGTCTGGGGTGG + Intergenic
1187292381 X:17967487-17967509 CTGATTCAGCAGCTCTGGAGTGG + Intergenic
1187345782 X:18462411-18462433 CTGAATCAGTAGGTCTGGAGTGG - Intronic
1187480123 X:19647834-19647856 CTGATTGAGAAAGCCTGGGGTGG - Intronic
1187510528 X:19913584-19913606 CTGATTCAGGAGGTCTGGGGTGG + Exonic
1187566493 X:20454659-20454681 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1187580102 X:20598221-20598243 CTCAATCAGAAACTTGGGGGTGG - Intergenic
1187716277 X:22105404-22105426 CTGAATCAGAATCTGTGGGGTGG - Intronic
1187767184 X:22655214-22655236 CTGATTCTGAAACTCTGGGGTGG - Intergenic
1187827385 X:23345604-23345626 CTGAGTCAGTAGGTCTGGGGTGG + Intronic
1187882232 X:23857955-23857977 CTGATTCAGTCAGTCTGGGGTGG + Intronic
1187969917 X:24648713-24648735 CTGATTCAGTAAGTCTGGGGTGG + Intronic
1187969982 X:24649375-24649397 CTGATTCAGTAGGTCTGGGGTGG - Intronic
1188009788 X:25043503-25043525 CTGAATTAGAAACTCTTGGGTGG - Intergenic
1188286959 X:28338939-28338961 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1188362683 X:29275236-29275258 CTGAATCTGAAACTCTGAGAGGG + Intronic
1188398309 X:29713570-29713592 CTGAATCAAAAACTCAGTGTTGG + Intronic
1188567990 X:31548279-31548301 CTAAATCAGAATCTCTGTGGTGG + Intronic
1189028423 X:37424368-37424390 TGGCATCAGAAACTCTGGGGTGG + Intronic
1189131324 X:38500805-38500827 CTGAATAAGAATCTCTGGATTGG + Intronic
1189148380 X:38678922-38678944 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1189186369 X:39058898-39058920 CCGAATCAGAAACTCTGGGAGGG + Intergenic
1189277720 X:39798920-39798942 CAGAATCAGAAGTTGTGGGGTGG - Intergenic
1189363035 X:40368173-40368195 CTGATTCAGCAAGTCTGAGGTGG - Intergenic
1189575750 X:42351301-42351323 TGGAATCAGAAACTCTCTGGTGG - Intergenic
1189596411 X:42570989-42571011 CTAAATCAGTAGGTCTGGGGTGG - Intergenic
1189615036 X:42774402-42774424 CTGAATCAGTAGGTCTGGGATGG + Intergenic
1189647929 X:43154429-43154451 CTGAATCAGACACTCTGGGGTGG - Intergenic
1189672682 X:43427628-43427650 CTGTATTAGAATCCCTGGGGTGG + Intergenic
1189677267 X:43474314-43474336 CTAAATCAGAATTTCTGGAGTGG - Intergenic
1189735947 X:44069994-44070016 CTGATTCAGAAGTTCTGTGGTGG + Intergenic
1190019921 X:46864731-46864753 CTGAATCAGGCTTTCTGGGGTGG - Intronic
1190827640 X:54032236-54032258 CTGATTCAGTCAGTCTGGGGTGG + Intronic
1190887068 X:54539650-54539672 CTGAATCAGAAACTCTGAGGTGG - Intronic
1191666094 X:63704315-63704337 CTGATTCAGTAAGTCTGGGTTGG + Intronic
1191676186 X:63794733-63794755 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1191786359 X:64920825-64920847 CAAAATCAGAAAATCAGGGGTGG + Intronic
1192018236 X:67355460-67355482 CAGAATGGGAAATTCTGGGGTGG - Intergenic
1192439340 X:71163372-71163394 AGGAATCAGAAACTCTGGGGTGG - Intronic
1192569500 X:72191216-72191238 CTGCATCAGAATCTCTTGGAGGG + Intronic
1192684966 X:73294248-73294270 CTGAATAGGAAAGTCTGGGTTGG - Intergenic
1192819260 X:74626355-74626377 CTGATTCAGTAGGTCTGGGGTGG + Intergenic
1193174264 X:78373615-78373637 CTGAATCTGAAGCTCAGGGAGGG + Intergenic
1193687354 X:84593353-84593375 CTGAATATGAAATTCTGGGTTGG - Intergenic
1193781268 X:85704159-85704181 CTGAATCAGAAACTGTGGTGTGG - Intergenic
1194011845 X:88571180-88571202 CTGATTCAGCAAGTCTGGGGTGG + Intergenic
1194597965 X:95882684-95882706 TTGAATGAGAAACTCTGTGTAGG - Intergenic
1194726326 X:97401665-97401687 CTGAATAAGAAACTGGGTGGGGG + Intronic
1194897942 X:99468896-99468918 CTGCACCATAATCTCTGGGGAGG - Intergenic
1194985612 X:100486468-100486490 CTGAATCAGAAACTATGGCAGGG - Intergenic
1195412572 X:104584088-104584110 TTGAATCAGATTCTCTGGGGTGG - Intronic
1195503172 X:105626920-105626942 CTGAATCAGAATCTCTGAGGGGG - Intronic
1195767945 X:108316621-108316643 CTGAATCATAAACTTTAGGGTGG + Intronic
1195961210 X:110388666-110388688 CTGAACCAGAAACTCAGGGGTGG - Intronic
1195981230 X:110580697-110580719 CTGATTCAGTAAATCTGGGTTGG + Intergenic
1196089442 X:111724314-111724336 CTGATTCAGTAAGTCTGAGGTGG + Intronic
1196111430 X:111951195-111951217 TTGAATCAGAAACTCTGGGGTGG - Intronic
1196116445 X:112004604-112004626 CTAAATCAGACACTCTGAGATGG + Intronic
1196117709 X:112015331-112015353 CTGAATCAGAAACTCTGAGAGGG - Intronic
1196417229 X:115484380-115484402 CTAAATCAGAAATTCAGGGTGGG + Intergenic
1196576082 X:117320723-117320745 CTGATTCAGAAAGTCTGAGGTGG - Intergenic
1196746630 X:119077034-119077056 CGGAATCCGAAAATCTGGGGTGG + Intergenic
1196820616 X:119697511-119697533 TTAAATCAGAAACTCTGTGAAGG + Intergenic
1196820641 X:119697706-119697728 CTGAATCAGAACTTCTAGGATGG + Intergenic
1196948764 X:120854812-120854834 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1196963950 X:121035152-121035174 CTGATTCAGTAAATCTGGGGTGG - Intergenic
1197135347 X:123053593-123053615 CTGAATCATAAACTCTCGAGTGG + Intergenic
1197995234 X:132365869-132365891 CTGAATCAGAAATTGTGGGGTGG + Intergenic
1198090704 X:133326401-133326423 CTGATTCAGTAACTCTGGGGTGG - Intronic
1198651145 X:138865006-138865028 CTCAATTAGAAACTCCTGGGTGG - Intronic
1198685146 X:139220922-139220944 CTGATTCAGAAAGTCTGGGGTGG - Intronic
1198737280 X:139800568-139800590 CTGAATCAGAAGCTCAGGGATGG - Intronic
1198789373 X:140326937-140326959 GTGGATCACACACTCTGGGGTGG + Intergenic
1198851453 X:140968987-140969009 CAGATTCAGAAACTGAGGGGAGG - Intergenic
1199008893 X:142735730-142735752 CTGATTCAGCAAGTCTGGGGTGG + Intergenic
1199677593 X:150200926-150200948 CTAAATCAGAATCTCAGGGTCGG + Intergenic
1199725473 X:150575653-150575675 CTGATTCAGTAGGTCTGGGGTGG + Intronic
1199737939 X:150702309-150702331 CTGATTCAGTAAATCTGGGATGG - Intronic
1199933792 X:152551664-152551686 CTGATTCAGCAGGTCTGGGGTGG + Intergenic
1199936150 X:152575500-152575522 CTGAGTCAGAAACTCCAGGGTGG + Intergenic
1200369337 X:155705329-155705351 GTGTATCATAAACTCTGGGAAGG + Intergenic
1201569188 Y:15396137-15396159 CAGAATCAGAAACTGGGGTGGGG + Intergenic
1201893416 Y:18967969-18967991 CTAAATCAGAACTTCTGGGATGG - Intergenic