ID: 929784883

View in Genome Browser
Species Human (GRCh38)
Location 2:44982272-44982294
Sequence TTACTGAATCAGAAACTCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3150
Summary {0: 18, 1: 161, 2: 463, 3: 902, 4: 1606}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784883_929784890 -7 Left 929784883 2:44982272-44982294 CCCCAGAGTTTCTGATTCAGTAA 0: 18
1: 161
2: 463
3: 902
4: 1606
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784883_929784891 -6 Left 929784883 2:44982272-44982294 CCCCAGAGTTTCTGATTCAGTAA 0: 18
1: 161
2: 463
3: 902
4: 1606
Right 929784891 2:44982289-44982311 CAGTAAATCTGCTGGGATGGGGG No data
929784883_929784892 -5 Left 929784883 2:44982272-44982294 CCCCAGAGTTTCTGATTCAGTAA 0: 18
1: 161
2: 463
3: 902
4: 1606
Right 929784892 2:44982290-44982312 AGTAAATCTGCTGGGATGGGGGG No data
929784883_929784888 -9 Left 929784883 2:44982272-44982294 CCCCAGAGTTTCTGATTCAGTAA 0: 18
1: 161
2: 463
3: 902
4: 1606
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784883_929784889 -8 Left 929784883 2:44982272-44982294 CCCCAGAGTTTCTGATTCAGTAA 0: 18
1: 161
2: 463
3: 902
4: 1606
Right 929784889 2:44982287-44982309 TTCAGTAAATCTGCTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784883 Original CRISPR TTACTGAATCAGAAACTCTG GGG (reversed) Intergenic
Too many off-targets to display for this crispr