ID: 929784884

View in Genome Browser
Species Human (GRCh38)
Location 2:44982273-44982295
Sequence TTTACTGAATCAGAAACTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784884_929784889 -9 Left 929784884 2:44982273-44982295 CCCAGAGTTTCTGATTCAGTAAA No data
Right 929784889 2:44982287-44982309 TTCAGTAAATCTGCTGGGATGGG No data
929784884_929784888 -10 Left 929784884 2:44982273-44982295 CCCAGAGTTTCTGATTCAGTAAA No data
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784884_929784891 -7 Left 929784884 2:44982273-44982295 CCCAGAGTTTCTGATTCAGTAAA No data
Right 929784891 2:44982289-44982311 CAGTAAATCTGCTGGGATGGGGG No data
929784884_929784890 -8 Left 929784884 2:44982273-44982295 CCCAGAGTTTCTGATTCAGTAAA No data
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data
929784884_929784892 -6 Left 929784884 2:44982273-44982295 CCCAGAGTTTCTGATTCAGTAAA No data
Right 929784892 2:44982290-44982312 AGTAAATCTGCTGGGATGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784884 Original CRISPR TTTACTGAATCAGAAACTCT GGG (reversed) Intergenic
No off target data available for this crispr