ID: 929784885

View in Genome Browser
Species Human (GRCh38)
Location 2:44982274-44982296
Sequence ATTTACTGAATCAGAAACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2907
Summary {0: 4, 1: 42, 2: 332, 3: 833, 4: 1696}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784885_929784891 -8 Left 929784885 2:44982274-44982296 CCAGAGTTTCTGATTCAGTAAAT 0: 4
1: 42
2: 332
3: 833
4: 1696
Right 929784891 2:44982289-44982311 CAGTAAATCTGCTGGGATGGGGG No data
929784885_929784892 -7 Left 929784885 2:44982274-44982296 CCAGAGTTTCTGATTCAGTAAAT 0: 4
1: 42
2: 332
3: 833
4: 1696
Right 929784892 2:44982290-44982312 AGTAAATCTGCTGGGATGGGGGG No data
929784885_929784889 -10 Left 929784885 2:44982274-44982296 CCAGAGTTTCTGATTCAGTAAAT 0: 4
1: 42
2: 332
3: 833
4: 1696
Right 929784889 2:44982287-44982309 TTCAGTAAATCTGCTGGGATGGG No data
929784885_929784890 -9 Left 929784885 2:44982274-44982296 CCAGAGTTTCTGATTCAGTAAAT 0: 4
1: 42
2: 332
3: 833
4: 1696
Right 929784890 2:44982288-44982310 TCAGTAAATCTGCTGGGATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784885 Original CRISPR ATTTACTGAATCAGAAACTC TGG (reversed) Intergenic
Too many off-targets to display for this crispr