ID: 929784886

View in Genome Browser
Species Human (GRCh38)
Location 2:44982281-44982303
Sequence TTCTGATTCAGTAAATCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784881_929784886 -10 Left 929784881 2:44982268-44982290 CCCACCCCAGAGTTTCTGATTCA 0: 23
1: 185
2: 539
3: 1101
4: 2226
Right 929784886 2:44982281-44982303 TTCTGATTCAGTAAATCTGCTGG No data
929784877_929784886 23 Left 929784877 2:44982235-44982257 CCTGGAGGCTTATTCAAGCACAG No data
Right 929784886 2:44982281-44982303 TTCTGATTCAGTAAATCTGCTGG No data
929784880_929784886 -9 Left 929784880 2:44982267-44982289 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 929784886 2:44982281-44982303 TTCTGATTCAGTAAATCTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784886 Original CRISPR TTCTGATTCAGTAAATCTGC TGG Intergenic
No off target data available for this crispr