ID: 929784888

View in Genome Browser
Species Human (GRCh38)
Location 2:44982286-44982308
Sequence ATTCAGTAAATCTGCTGGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
929784881_929784888 -5 Left 929784881 2:44982268-44982290 CCCACCCCAGAGTTTCTGATTCA 0: 23
1: 185
2: 539
3: 1101
4: 2226
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784883_929784888 -9 Left 929784883 2:44982272-44982294 CCCCAGAGTTTCTGATTCAGTAA 0: 18
1: 161
2: 463
3: 902
4: 1606
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784882_929784888 -6 Left 929784882 2:44982269-44982291 CCACCCCAGAGTTTCTGATTCAG 0: 16
1: 78
2: 173
3: 399
4: 1174
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784884_929784888 -10 Left 929784884 2:44982273-44982295 CCCAGAGTTTCTGATTCAGTAAA No data
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784877_929784888 28 Left 929784877 2:44982235-44982257 CCTGGAGGCTTATTCAAGCACAG No data
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data
929784880_929784888 -4 Left 929784880 2:44982267-44982289 CCCCACCCCAGAGTTTCTGATTC 0: 21
1: 62
2: 270
3: 802
4: 1803
Right 929784888 2:44982286-44982308 ATTCAGTAAATCTGCTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
929784888 Original CRISPR ATTCAGTAAATCTGCTGGGA TGG Intergenic
No off target data available for this crispr